5'.GTCTCTTGACATTG... 3' What is the MRNA sequence transcribed from this sequence (assume the transcription start site is before this sequence) 5'.GUCUCUUGACAUUG...3' 5'.GUUACAGUUCUCUG..3' 5'.CAGAGAACUGUAAC...3' 5'.CAAUGUCAAGAGAC.3'

5'.GTCTCTTGACATTG... 3' What is the MRNA sequence transcribed from this sequence (assume the transcription start site is before this sequence) 5'.GUCUCUUGACAUUG...3' 5'.GUUACAGUUCUCUG..3' 5'.CAGAGAACUGUAAC...3' 5'.CAAUGUCAAGAGAC.3'

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Related questions

Q: Describe the absorption of light in your own words.

A: Plants use pigments to facilitate the conversion of light energy into chemical energy. The chloropla...

Q: What are the key features of schizophreniform disorder?

A: Introduction Schizophrenia is a brain disorder/mental disorder which can occur due to several reaso...

Q: | BRCA1 is a bi-allelic gene (let's call the two alleles as C and c) that is inherited on an autosom...

A: Epistasis is a phenomenon by which a dominant allele of a gene prevents the expression of alleles of...

Q: Weight Metabolism 3.6 Animal Animal Weiglht Metabolism Mouse 0.021 23.6 Dog Chimpanzee Sheep 872 Rat...

A: Allometry -- Allometry is an empirical expression of the distribution of biomass between aboveground...

Q: Describe the life cycle of Malaria.

A: Introduction The malaria parasite can be found in both humans and female Anopheles mosquitos. Becaus...

Q: Organic monomers joined to form organic polymers is the stage number evolutionary biologists. of the...

A: Origin of life: Stanley L. Muller and Harold C. Urey first conducted the experiment to show origin o...

Q: Match each of the follwoing

A: In 1961, Matthaei became the first to describe the structure of a codon. tRNA is a literal "adaptor"...

Q: EPITHELIUM IN NO

A: Epithelium is refers to layers of cells that line hollow organs and glands.

Q: 1. IDENTIFY THE BASIC TYPE OF EPITHELIUM. 2. GIVE THE SPECIFIC NAME OF THE EPITHELIUM. 3. IDENTIFY T...

A: A stratified squamous epithelium is a flattened epithelial tissue that are arranged in layers over a...

Q: Use the diagram below to answer Questions #2-4. 2. Draw arrows between the organisms to show how ene...

Q: Where is the cytoplasm located in the anabaena and is the cytoplasm interconnected?

A: Given: Anabena is a genus of nitrogen fixing cyanobacteria blue green algae. Colonies grow in filame...

Q: Mendel testcrossed grown from green, L yellow, round; 26 gr Are these results co

A: A test cross is an experimental cross of an individual organism of dominant phenotype but unknown ge...

Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...

A: Introduction The cell is life's most fundamental structural and functional unit. Cells are the build...

Q: Which one is NOT the cause of hypoxic hypoxia? . emphysema . hypoventilation . high altitude . c...

A: Hypoxia is a condition that occurs when there is reduced level of oxygen in the tissues. There are d...

Q: Sponge archeocytes can differentiate into A. eggs (oocytes) B. sperm C. choanocytes D...

A: Sponges are organised at a cellular level. They don't have any features that may be classified as or...

Q: e blank with the correct dilution for each tube in the series. tou 50 µl of patient serum 100 µl of ...

A: Dilution is the technique of lowering the concentration of a solute in a solution by merely adding m...

Q: Explain in detail Structure reproduction and life cycle of agaricus.

A: Introduction :- Agaricus, popularly known as mushroom, is an edible fungus. It's a saprophytic fungu...

Q: A scientist studying a species of algae, Gracilaria domingensis, discovered that its color is contro...

A: Alleles can be described as the different forms associated with particular gene. The formation of ge...

Q: • 1. Identify the tissue. • 2. Identify the structures pointed by letter "A." • 3. Identify the stru...

A: The group of cells which function together and have same structure are called as tissues.

Q: Which of the following statements about CRISPR are accurate? Select all that apply. O CRISPR require...

A: The most accurate statements regarding CRISPR are - a, c and e.

Q: It is a fact that insects are widely distributed in any type of ecosystem. Some are vectors of causa...

A: Unlike the closed circulatory system found in vertebrates, insects have an open system lacking arter...

Q: 4. An X-linked dominant trait with an unaffected mother and an affected father.

A: X linked dominant This type of Inheritance refers to the mutations in the genes that are present on...

Q: A section of DNA has following sequence of nitrogenous bases: CGATTACAG. Which of the following sequ...

A: Transcription is a process of copying a piece of DNA into RNA.

Q: Which of the following graphically shows the evolution of protein sequences? O Blosum-62 BLAST O ide...

A: Protein Sequencing: Protein sequencing is the technique of determining the amino acid sequence of a...

Q: What should be the complementary strand of 3'-ATGGCTTGA-5'? Select one: a. 5'-TACCGAACT-3' b. 3'-TAG...

A: DNA or deoxyribonucleic acid is a double stranded polynucleotide that is present within the nucleus,...

Q: Differentiate the following

A: Cytoplasm is a thick solution which fills each cell and is enclosed by the cell membrane.

Q: Describe concurrent exchange in your own words.

A: As human use lungs to breathe, fishes breathe through their gills. Their gills have small structures...

Q: Bacillus cereus and Bacillus thuringiensis are very closely related species and cannot be distinguis...

Q: If hydrologic cycle is a continuous movement of water, why drought and/or flooding occurs? Explain.

A: In the Earth-Atmosphere system, the hydrologic cycle entails the continual flow of water. The water ...

Q: Explain characteristics of oomycota? Explain characteristics of mucarales ?

A: Unlike to fund the members of the Phylum oomycota lack chitin in their cell walls and have a life cy...

Q: DISEASE CAUSATIVE ORGANISM VECTOR

A: Causative organism or agent in infection are pathogens. vector is a quantity or phenomenon that has...

Q: In a species of tree, seed color is determined by four independently assorting genes: A, B, C, and D...

A: Genetics is a branch of the biology involved in the study of genes, genetic variation, and heredity ...

Q: n rats, black fur color is dominant to white fur color, and pointy ears are dominant to round ears. ...

A: Introduction: Law of independent assortment is based on dihybrid cross. It states that inheritance ...

Q: Refer to the above diagram to answer the question. a) Which group is most closely related to humans....

A: Humans are classified as primates and are members of the Hominidae (Great Ape) family on the broader...

Q: Pulmonary function tests (or measurements) can be classified as either static or dynamic. Explain th...

A: Pulmonary function tests are important examinations in the care of patients with respiratory disease...

Q: Researchers designed an observational study to investigate the effects of hormone replacement therap...

A: Hormone replacement theory is defined as a technique used to treats the female menopause symptoms. ...

Q: What are 5 facts about fermentation?

A: Introduction: Pyruvic acid is a 3 carbon compound formed as the end product of glycolysis. Glycolys...

Q: What is a primate and why do anthropologists consider it important to study them? What features do p...

A: Primates is belong to those groups of animals, thats under included humans, monkeys and animals like...

Q: You mix a few drops of a patient’s blood with ABO and Rh typing serums (antibodies against A, B, & R...

A: Introduction The presence of particular antigens, or blood group components, on human red blood cell...

Q: Remove the agar plate from its lid with the left hand. While holding the plate, inoculate the agar h...

A: Introduction -- Microbes are around and every where in environment. Sterile agar plates which provid...

Q: What are some new, simple, and unique transgenic organism in today’s time that can be useful

A: In animals, kingdom different phylum is present like Chordata, Hemichordata, Echinodermata, Mollusca...

Q: Differentiate bioaccumulation and biomagnification and Explain how COVID19 wastes like face masks an...

A: Bio-accumulation and bio-magnification are parameters used to analyze the impact of a pollutant /tox...

Q: Fill in the blank with the most appropriate term that is described by the following statement: Close...

A: The components of DNA replication. A five-membered, oxygen-containing ribose sugar ring with three p...

Q: o What is a pure culture? o Describe the procedure for making a streak plate from a clinical specime...

A: Introduction A growth media, also known as a culture medium, is a solid, liquid, or semi-solid mediu...

Q: A DNA

A: DNA acts as the genetic material in most of the organisms . DNA stands for the deoxyribonucleic acid...

Q: What is the Solubility Properties of Annatto Seeds?

A: Annatto seeds are derived from Bixa orellano tree,native to tropical regions.Annatto seeds are used ...

Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the MR...

A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and archae...

Q: Identify the fibrous materials seen on the field.

A: Introduction Tissue which is composed of bundles of collagenous white fibres between which rows of ...

Q: J. ach compound on the left with its name on the right. Match the name with the functional E. group ...

A: Functional groups are atoms that bind to an organic molecule's carbon backbone and give certain prop...

Q: Define Chronic Bronchitis: ( 1pt) What makes a condition chronic? (1pt) COPD is the abbreviation for...

A: chronic bronchitis :-- it is a lung condition that develops over time in which the bronchi which is ...

Concept explainers

Clinical Pharmacology

Pharmacology is a discipline of medicine that studies how medications interact with the systems and processes of living organisms, focusing on drug action mechanisms as well as therapeutic and other purposes.

Question

100%

please help with question a bit confusing

5'.GTCTCTTGACATTG... 3'
What is the mRNA sequence transcribed from this sequence (assume the transcription start site is before this sequence)
5'.GUCUCUUGACAUUG...3'
5'.GUUACAGUUCUCUG...3'
5'.CAGAGAACUGUAAC...3'
5'.CAAUGUCAAGAGAC..3'

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1 explanation of answer

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this mRNA? (b) What dipeptide is formed if a mutation converts CUG to CUU? (c) What dipeptide is formed if a mutation converts CAC to CGC? (d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?
5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s
Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
the translate on the mRNA in 5'AAA-AAA-AAA-AAA-AAA3' is?
Which sequence is most likely to be found in a promoter? a) CGGTGTATATCGTAC b) GTACAGTCATCCCGT c) AAATCTACTACGATT d) GGGTTGGGTTGGGTT
The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-C
Your investors are concerned that the GasP protein might not be sufficiently produced under normal laboratory conditions. They suggest controlling the transcription of the gasP gene using a chemical that will “trigger” its transcription. a. What type of promoter could be used? b. What chemical will you use to control transcription? c. How does this method of control work?
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
Describe three (3) ways in which the primary transcript is modified as it is converted to mRNA.
What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5′ or 3′) of the template strand is the promoter located?
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
Discuss the three steps of Transcription (Initiation, Elongation, Termination).