the translate on the mRNA in 5'AAA-AAA-AAA-AAA-AAA3' is?

Q: Derive the amino acid sequence that is coded for by the following mRNA sequence. 5' CAU AAA ACG GUG…

A: During the translation, the information present in the mRNA sequence results in the formation of…

Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…

A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…

Q: A) Draw the mRNA to be translated if the pre-mRNA is constitutively spliced. [ 3) Draw an mRNA to be…

A:

Q: What is the name for the complex that forms when many ribosomes translate the same MRNA at the same…

A: Polyribosomes are the complex of multiple ribosomes which translates the same mRNA.…

Q: Which of the following is not a possible size (in bp) of the mature mRNA? a. 205bp b. 180bp c. 150bp…

A: Need to find the mature mRNA in above options

Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…

A: Genetic code consists of four letters 'GACU' which stands for guanine, adenine, cytosine, and uracil…

Q: Translating the unmutated MRNA that was obtained after splicing, the original protein sequence will…

A:

Q: What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap…

A: The predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’…

Q: Write the functions of UTR of mRNA

A: Transcription is the process in which single-stranded RNA molecules are produced by RNA polymerases.…

Q: Draw the SMN2 pre-mRNA (10 exons and 9 introns), indicate the 5’ and 3’ SS location. Draw the SMN2…

A: Proteins are obtained from DNA that contains the required genetic information. DNA is first…

Q: A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…

A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…

Q: During transcription, how many RNA nucleotide bases would usually be encoded by a sequence of 99 DNA…

A: Transcription is the first step of making a protein from DNA instructions. The human genome is made…

Q: recognition of the AUG initiation codon in an mRNA is TRUE?

A: In eukaryotes and Archaea, the start codon always codes for methionine, while in bacteria,…

Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3

A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which the mRNA, transcribed from the template strand of the…

Q: The anticodon loop of the first tRNA that will complement this MRNA is Select one: O a. 5'-ACG-3' O…

A: Messenger RNA (mRNA): mRNA is a single-stranded RNA molecule that is complementary to one of the DNA…

Q: In which reading frame will this mRNA be read? 5'- ACAG C C U G CA A GU C A CU GACG- 3' O 1st O 2nd…

A: The order of amino acids in a protein from the N-terminus to the C-terminus is specified by mRNA…

Q: Which of the following is NOT a component of the 30S initiation complex? A. EF-Tu and EF-Ts B.…

A: Translation Translation involves the transfer of information in mrna molecules into the aminoacidsl…

Q: of mRNA that contains a total of 66 codons. What is the maximum number of amino acids that could be…

A: The formation of mRNA from DNA is called transcription and from mRNA to a protein called…

Q: The following is a portion of an mRNA sequence:   3’ –AUCGUCAUGCAGA-5’ a)During transcription, was…

A: The synthesis of RNA (ribonucleic acid) from DNA (deoxyribonucleic acid) by the enzyme RNApolymerase…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: An mRNA molecule is synthesized in the 5'-to-3' direction. is that true or false? explain why pls

A: During transcription DNA is unwind at promoter region by RNA polymerase . Now two single strand are…

Q: Define the following terms:a. cohesinb. transcription factoryc. P bodiesd. CTCFe. ENCODE

A: There are cellular pathways that help to transfer genetic information and encode it to the protein.…

Q: Which two sequences shown in the diagram are NOT directly transcribed from the template strand of…

A: ANSWER - in this figure the following sequences are not directly transcribed from the template…

Q: In bacteria, single polycistronic MRNA encodes for:

A: This question is based on polycistron.

Q: B. Transcript and Translate the following: DNA-TACTGATCGACCCCCATA ATGAAAATCGGGCCC MRNA- AA- DNA -…

A: Coding DNA strand and mRNA has same sequence except T in DNA and U in RNA  mRNA - Complementary to…

Q: Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU…

A: Translation Process by which the mRNA codes for a particular protein is known as translation.

Q: From TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC. Translate the mRNA sequence.

A: The givem template sequence is as follows,  TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC Template strand…

Q: Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can…

A: Answer: Central dogma  replication----> transcription -------> translational  DNA-------->…

Q: Could two mRNAs have different nucleotide sequences and yet code for the same protein? Explain.

A: mRNA brings information from the DNA for the formation of particular type of polypeptide. Therefore,…

Q: Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA?…

A: Genetic codes are unambiguous that means one codon will code for only one amino acid. Codons are…

Q: How would the deletion of the Shine–Dalgarno sequence affect a bacterial mRNA?

A: A ribosomal binding site is a sequence of nucleotides upstream of the start codon of an mRNA…

Q: Describe the significance of a 5 cap poly A tail on the mature mRNA

A: mRNA- is a coding sequence of a gene implicated in the synthesis of protein, approximately, 4% of…

Q: Follow the path of codons to discover the peptide and unlock the Directional Multilock. (Hint: type…

A: Peptide formed from given mRNA sequences.

Q: Write out the sequences of the two conserved elements in the following bacterial promoter. The…

A: In the transcription unit, the transcription start site is marked as +1.

Q: Assuming that each nucleotide is 0.34 nm long in mRNA, howmany triplet codes can simultaneously…

A: Nucleotide : It is an organic molecule that is the building block of DNA and RNA. They also have…

Q: Given the following coding strand of DNA: 3' – TACCGAGTACTGACT – 5', the mRNA that will transcribed…

A: The method of constructing an RNA copy of a genetic sequence is known as transcription. The copy,…

Q: If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA…

A: The central dogma of life involves three major steps that include: DNA replication: This is the…

Q: In eukaryotic mRNA there are 90 nucleotide involved in translation process. What is the number of…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……

A: Bacterial transcription is the process in which a segment of bacterial DNA is copied into a newly…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation of m RNA to peptides occurs in the ribosomes. there are three different sites…

Q: a) What is the region of the MRNA with all of the X's in this image called?

A: Translation is the process of formation of amino acid sequence using messenger RNA as a template and…

Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. What is the…

A: The coding sequence of the Gene F and G are given as                                        5'…

Q: What would be the minimum length(approximate number of bases) of an mRNAthat coded for a protein 300…

A: To determine: To determine the required minimum length of an mRNA that is coded for a protein of 300…

Q: 8. ----ATTATA--- ----TAATAT--- Fill in the polarity of the strands? Which strand is the coding…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Name the process in which unwanted mRNA regions are removed & wanted regions are joined.

A: Transcription is a process in which the DNA template is synthesized into mRNA. At the end of…

Q: Identify the different regions of the mature mRNA by matching terms with regions. regions are shown…

A: Answer. Eukaryotic m RNA are mostly monocistronic having an average size of 1500 to 2000…

Q: Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation…

A: The start codon for eukaryotes is methionine. There are different initiation codons for different…

Q: Given the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid…

A: DNA => Transcription => mRNA => Translation => Protein. Given DNA sequence: 5' ATG CTT…

Q: CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT…

A: The process of synthesizing mRNA strand with the help of template stand of DNA is called…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.