What is a primate and why do anthropologists consider it important to study them? What features do primatologists look for to distinguish between prosimians, new world monkeys, old world monkeys and apes

Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...

A: Introduction The cell is life's most fundamental structural and functional unit. Cells are the build...

Q: A space probe returns from Mars where it has collected a new microorganism. It has double- stranded ...

A: Introduction: DNA replication is the basis of biological inheritance in all living beings. The proce...

Q: 5.1) Do you expect DNA strands 1 and 2 below to have the same melting point? Justify your answer. S...

A: As per bartleby guidelines we are only allowed to answer one question. Please post the other questio...

Q: How does temperatire, precipitation, humidity affect the distribution of Pinus massoniana?

A: INTRODUCTION      In the biodiversity the terrestrial ecosystem played a major role in the global ca...

Q: Which one inhibits osteoclasts?

A: Osteoclasts are the cells which degrades bone to start normal bone remodeling and mediate bone loss....

Q: What is the reason why they are just all called pulp stones?

A: Pulp stones are nodular, calcified masses appearing in either or both the coronal and root portion o...

Q: can you please explain to me how twin studies can reveal whether or not the appearance of a trait is...

A: Identical twins share the same Genetic pattern whereas non identical twins doesn't have the same Gen...

Q: A reaction in an anabolic pathway is found to have a large negative Gibbs Free energy. How likely is...

A: Gibbs free energy is basically defined as the amount of work done in the thermodynamic process when ...

Q: What is a tissue cell

A: All the life forms are composed of one or more cells.  

Q: 3. Which line graph shows t@2 vehicle slowing down? Time (seconds)

A: In fig .1, given the distance versus time graph.From this speed of the vehicle at Every second is in...

Q: In maize, A and Bgenes are linked at 12 cM apart. If a plant of AblaB is selfed, what proportion of ...

A: Introduction :- A gene is a basic unit of heredity in biology, consisting of a sequence of nucleotid...

Q: Antibodies are chemicals that the immune system make to attack viruses and bacteria. Each type of an...

A:

Q: Q6. This figure shows the sequence alignment of five (5) different Src homology 2 (SH2) domains, all...

A: sequence alingment  is the method of comparing the similarities between the biological sequences pre...

Q: DHCR7 (7-dehydrocholesterol reductase) gene.

A: This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyz...

Q: ter reading the “Using spectrophotometers to study a Catechol Oxidase Reaction section, copy into yo...

A: Catechol Oxidase reaction is the process or reaction known to cause browning of the fruits when the ...

Q: Explain how viruses and prions are both similar and different.

A: ANSWER;- 1)  Prions are smaller than viruses and must be seen through an electron magnifying lens wh...

Q: e blank with the correct dilution for each tube in the series. tou 50 µl of patient serum 100 µl of ...

A: Dilution is the technique of lowering the concentration of a solute in a solution by merely adding m...

Q: Does that mean if someone is a carrier the genotype will be Fh/fh? Because Fh is the diseased allele...

A: *Carriers means a person who carries a genetic mutation and can pass this genes to next generation a...

Q: Discuss the pathway that secretory proteins (proteins destined to leave the cell) take through the e...

A: protein synthesis occur in ribosome structure and after protein synthesis, protein modification occu...

Q: In secondary growth, grows inward towards the middle of the stem, and grows outwards towards the edg...

A:   The majority of plants have the capacity to grow throughout their life, which is in contrast to an...

Q: There is a fish species that lives in a lake. As the fish population grows, competition for  food in...

A: A population is the collection of all individuals of the same species located in a particular area a...

Q: Illustrate and discuss the life cycle of Enterobius vermicularis.

A: Enterobius vermicularis::  The Enterobius vermicularis is a parasitic worm that is also known as thr...

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...

A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...

Q: How significant is cellulose tape perianal swab to the control of pinworm infection in the community...

A: Pinworms are parasitic worms that are also known as threadworms or seatworms. It's a nematode and a ...

Q: How do plant react to certain change like irritation/sensitivity

A: The sensation is one of the capacities shown by a residing creature to keep up with its life, where ...

Q: In order to sexually reproduce, multicellular organisms utilize a process called ______. The type of...

A: Meiosis is defined as the key process of sexual cycle in eukaryotic organisms. In this process, a si...

Q: describe the difference in color between the leaf which was fully exposed to sunlight and the one wh...

A: The process by which green plants and some other lower living beings prepare their food in the prese...

Q: Explain how Bacara is used to isolate, differentiate and enumerate Bacillus cereus from  food sample

A: Bacillus cereus is a spore-producing Gram-positive bacterium present in the soil. The spores produce...

Q: g best describes the complete sequence of steps occurring during every cycle of PCR? I-The primers h...

A: A laboratory method used to make many copies of a specific piece of DNA from a sample that contains ...

Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...

A: A... Communication between two plant cell.. cell to cell communication. Through the plasmodesmata. B...

Q: Neodermatahas two classes: class Trematoda and class Monogenea. Class Trematoda has the subclass Dig...

A: Monogenea is flat worm, this is simple life cycle, this is ectoparasite, so less hamful.

Q: Why might adding a topoisomerase enzyme increase the sensitivity of an RT-Lamp assay. Would you expe...

A: Reverse transcription-polymerase chain reaction (RT-PCR) assay is used for the detection of coronavi...

Q: Please answer fast Create a gram-positive, catalase-negative flow chart (in flow chart diagram) to ...

A: It is critical that we understand microbes and their applications since they may be both useful and ...

Q: The activated sludge process was developed from empirical knowledge and is now widely used for wast...

A: Activated sludge-The activated sludge process is a type of wastewater treatment process for treating...

Q: Why do we need to assess the potential hazards in your community?

A: The term community is associated with the gathering of living organisms that can be found in a parti...

Q: Define isoenzymes

A: Enzymes are biocatalyst that helps increase the rate of chemical reactions and in the process, they ...

Q: the chemostat.

A: Chemostats in research are used for investigations in cell biology, which is a source for large volu...

Q: 5. solve and discuss genetics problems illustrating the different types of gene interactions, interp...

A: Gene -Gene Interaction --- The following points predict the gene - gene interaction between pairs of...

Q: Šize-dependent migration distances of DNA fragments in an agarose gel Length of DNA fragments (bp) D...

A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to answ...

Q: Discuss the ease of hydrolysis (break down) for each of the 4 polysaccharides (glycogen, amylose, am...

A: Food is an important energy source to carry on the normal physiological functions of the body. Plant...

Q: discuss comprehensively Distinguish between simple and complex carbohydrates.

A: Carbohydrates are the rich energy source synthesized in the process of photosynthesis. Carbohydrates...

Q: n rats, black fur color is dominant to white fur color, and pointy ears are dominant to round ears. ...

A: Introduction:  Law of independent assortment is based on dihybrid cross. It states that inheritance ...

Q: How do neurodegenerative diseases such as Alzheimer's and Parkinson's disease relate to the concept ...

A: Introduction :- The progressive loss of structure or function of neurons, known as neurodegeneration...

Q: Classify each example under the following characteristics of life (1) gathering and using energy, ...

A: Introduction Regardless of complexity, structure, habitat, or other factors, all living things on Ea...

Q: Place prokaryotes in the tree of life and discuss their significance.

A: Between the prokaryotes in the tree life is mutual relationship.   Some bacteria like frankia and an...

Q: Ctenophora Animals Porifera Placozoa Cnidaria Bilateria |Chanoflagellata What is true about the red ...

A: The correct answer is-  d) it includes the most recent ancestor and all of its descendants

Q: Give Definition, Symptoms/causes (give at least 2), and Treatment (give at least 2) Kidney Stones (n...

A: INTRODUCTION The definition, symptoms, causes and treatment of the disease in the question is given ...

Q: What is the Malthusian Theory? Is the Malthusian Theory applicable today or not at all? Please expla...

A: Introduction A population is a group of individuals of the same species who live in the same region ...

Q: Nematocyst toxins which paralyze prey are called

A: Introduction :-  Nematocysts, are a common feature of all cnidarians. They are enormous organelles t...

Q: Identify the conditions in which effervescent tablet can be tested for friability.

A: Answer 

Marine Evolution

Marine habitat is less explored, and hence, its biological diversity is far less known. The marine habitats are not constant due to their shifting nature, while the terrestrial habitats are more stable. Marine biology is the science that deals with the study of diverse marine species, their interactions, and behavioral characteristics.