6. Below is an image of a DNA replication fork. a. Label the leading and lagging strands as well as the 5' and 3' ends for each of the arrows on the newly synthesized DNA. DNA replication fork DNA unzips b. Explain why Okazaki fragments only form on the lagging strand during DNA replication.

6. Below is an image of a DNA replication fork. a. Label the leading and lagging strands as well as the 5' and 3' ends for each of the arrows on the newly synthesized DNA. DNA replication fork DNA unzips b. Explain why Okazaki fragments only form on the lagging strand during DNA replication.

Name: 6. Below is an image of a DNA replication fork.a. Label the leading a
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 6. Below is an image of a DNA replication fork.a. Label the leading and lagging strands as well as the 5' and 3' ends for each of the arrows on thenewly synthesized DNA.DNA replication forkDNA unzipsb. Explain why Okazaki fragments only form on the

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 4TYK: Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand...

See similar textbooks

Similar questions

Which of the following is/are not required for DNA replication to occur? a. DNA polymerase b. nucleotides c. template DNA d. primers e. helicase f. all are required
The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
n gel electrophoresis of DNA, the different bands in the final gel form because the DNA molecules _______. a. are from different organisms b. have different lengths c. have different nucleotide compositions d. have different genes
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
1. TRUE OR FALSE: a) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the synthesis of the new strand. b) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the synthesis of the new strand.
#1 under Identify the Structures is what.... A. original strands of DNA B. backbone of DNA C. nitrogen bases D. new copied strand of DNA
The elongation of the leading strand during DNA synthesis(A) progresses away from the replication fork.(B) occurs in the 3′ S 5′ direction.(C) produces Okazaki fragments.(D) depends on the action of DNA polymerase
(a) What is the function of helicase in DNA replication?(b) What is the function of DNA polymerase?(c) What are replication forks? Compare and contrast leading and lagging strands. Answer all please
ii) Assume that the following polynucleotide is part of a longer DNA molecule. Write out the product that would be obtained from its replication.3 AAGCTTTCCG
2. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? Group of answer choices a. C b. G c. A d. T
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity