7. A male fly that is homozygous for recessive alleles at two linked autosomal genes is mated with a wild-type female fly that is homozygous dominant for both alleles. All F, offspring are then randomly mated. If the genes are so close as to have no recombination, what proportion of offspring will be homozygous for both mutations in the F, generation? Briefly justify your answer.

Question
7. A male fly that is homozygous for recessive alleles at two linked autosomal genes is mated
with a wild-type female fly that is homozygous dominant for both alleles. All F, offspring are
then randomly mated. If the genes are so close as to have no recombination, what proportion of
offspring will be homozygous for both mutations in the F, generation? Briefly justify your
answer.
Expand
Transcribed Image Text

7. A male fly that is homozygous for recessive alleles at two linked autosomal genes is mated with a wild-type female fly that is homozygous dominant for both alleles. All F, offspring are then randomly mated. If the genes are so close as to have no recombination, what proportion of offspring will be homozygous for both mutations in the F, generation? Briefly justify your answer.

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Genetics

Related Biology Q&A

Find answers to questions asked by students like you.

Q: Which of the following acts as the natural pacemaker of the heart? Group of answer choices SA node E...

A: Heartbeat is an electro conductive impulse. This impulse is generated in heart itself at a particula...

Q: What is the pathway of the “filtrate?” Bowman’s Capsule è Urinary Bladder

A: The urinary system consists of the kidneys, ureters, bladder, and urethra. It eliminates waste from ...

Q: WHAT IF? Why is nutrient availability in a tropical rainforest particularly vulnerable to logging?

A: Tropical rainforest is a large, hot and moist naturally occurring community of flora and fauna where...

Q: some bodies of water, like the Dead Sea, have considerably higher salt concentrations than those of ...

A: The Dead Sea is termed as the dead sea because it has a high concentration of salt. It cannot suppor...

Q: Explain how the random alignment of homologous chromosomes during metaphase I contributes to the var...

A: During metaphase I, the chromosomes align at the center of the cell. This phase ensures that the two...

Q: Is it easier to exclude a suspect in a criminal case on the basis of DNA evidence, or it is easier t...

A: DNA profiling is a forensic technique used in criminal investigations. Here profiles of criminal sus...

Q: The following test results were reported in a patient over a 24 hour period: urine volume = 1.2 L ur...

A: As urine volume is given 1.2 L which is collected in the past 24 hour period. To calculate GFR  we n...

Q: What is commenalism?

A: Commensalism is a type of interspecific interaction.

Q: In the introduction to this chapter, we discussed the role of famine during early prenatal developme...

A: The central nervous system (CNS) appears at the beginning of the third week as a slipper-shaped plat...

Q: How will treatment for the second tuberculosis infection likely differ from the first round

A:     Tuberculosis is a serious disease caused by the bacteria Mycobacterium tuberculosis that mainly ...

Q: Which of the following statements is correct? Group of answer choices Veins carry blood away from th...

A: Veins  Veins are blood vessels that carry blood towards the heart. Stenotic heart valve Valve that...

Q: What will be the flower structure of a plant in which expression of the following genes is inhibited...

A: To understand the homeotic mutations (mutations leading to mismatched organs in the body of an organ...

Q: Identify the four main threats to biodiversity and explainhow each damages diversity

A: Biodiversity:   It is variability and varieties of life on earth. It is a measure of variation at sp...

Q: the compositions of esophagus and lung tissue by comparing their density when placed in water.

A: The oesophagus is a muscular tube that rapidly propels the food from pharynx into the stomach. It is...

Q: You are observing a species of mice in which brown fur color is dominant to white fur color. When a ...

A: Genetics may be defined as a branch of biology that mainly deals with the study of genes, genetic va...

Q: Which of the following would increase the resistance to blood flow? Group of answer choices All of t...

A: Blood is a fluid connective tissue that flows in the vessels of the circulatory system. Certain forc...

Q: What is food chain? Give example.

A: Sun is the only source of energy for all ecosystems. Plants, photosynthetic and chemosynthetic bacte...

Q: Name 5 organisms that can carry out nitrification, write the chemical reaction, what enzyme carries ...

A: The nitrogen cycle is the biogeochemical cycle by which nitrogen is fixed and also recycled back to ...

Q: Which of the following best demonstrates the unity among allorganisms?(A) emergent properties(B) des...

A: All the organisms have evolved from a common ancestor. The unity among organisms is explained based ...

Q: What are the sphincters in the digestive system from mouth to anus with its specific locations and f...

A: Digestion is the process that involves breakdown of complex food substances into simpler ones for ea...

Q: Which of the following would increase the resistance in a blood vessel? Group of answer choices All ...

A: Resistance is a force that opposes the flow of a fluid. The length of a vessel is directly proportio...

Q: Describe how the sea star respires.

A: The kingdom Animalia according to the five-kingdom classification by Robert Whittaker is divided int...

Q: Molecular geneticists have performed experiments in which they altered the number of copies of the b...

A: What are bicoid genes? Bicoid protein gradient formation is one of the earliest steps in fruit fly e...

Q: Bacteria are equipped with mechanisms that are capable of counteracting host defenses. Please choose...

A: Bacteria are single-celled microscopic organisms that can survive in a diverse environment. They are...

Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom ...

A: Transcription is the first step of central dogma or simply gene expression in which the DNA sequence...

Q: Using phages that came from E. coli with the genotype al+ be+, you infect a strain ofE. coli that is...

A: Auxotrophs are the term used for the organism or bacteria that cannot express a gene due to mutation...

Q: In preparing a site for surface mining and later restoration, why wouldengineers separate the topsoi...

A: Restoration ecology is a branch of ecology that deals with the restoration of the degraded, damaged ...

Q: Predict what would happen to the metabolic rate of the mouse if you increased the temperature. Predi...

A: Metabolism can be defined as a total of the reactions taking place in the body of an organism. Metab...

Q: Anatomy and physiology What type of fibers are found in elastic connective tissue and what protein t...

A: Connective tissue helps in maintaining the connections between tissues and organs. The main componen...

Q: Explain how the body’s first line of defense protects us from potentially harmful organisms.

A: Immunity:our body has a defense mechanism that can be used to fight with external invasion of pathog...

Q: Given: For urea, the rate of excretion equals to the GFR times the urea concentration in plasma. (A)...

A: Given that – Urea concentration in plasma – 4.5 mmol/l Excretion rate – 450 mmol/day To calculate – ...

Q: A controlled experiment is one that(A) proceeds slowly enough that a scientist can make carefulrecor...

A: Generally, biologists and other scientists uses a scientific method with an observation. This result...

Q: On which surface would you find the mouth?

A: The scientific anatomical terminology is utilized to refer to specific regions or parts of the body....

Q: DRAW IT (a) Draw a simplified global water cycle showingocean, land, atmosphere, and runoff from the...

A: Since the questions has two subdivisions, only the first option has been done. You can send the seco...

Q: What are the six criteria used to build a complete evolutionary branch of vertebrates?

A: Vertebrata is a sub-phylum under the phylum Chordata. The members of the subphylum Vertebrata posses...

Q: Distinguish between the hibernation and aestivation.

A: The importance of the sleep is mainly related to the conservation of energy of one’s body, survival ...

Q: What is the function of the madreporite?

A: Madreporite:   In the body of echinoderms madreporite is calcareous opening. It joins water vascular...

Q: Given that the function of egg yolk is to nourish and supportthe developing chick, explain why egg y...

A: Yolk is a very important part of the egg. It is stored in yolk sac.

Q: List three important ways in which your life would be different today if grassroots actions by U.S. ...

A: The three important ways in which your life would be different today if grassroots actions by U.S. c...

Q: Within each year, what is the pattern of change in CO2 concentration? Why might this pattern occur?

A: Carbon dioxide is an important constituent of the atmosphere and one of the major gases present in t...

Q: The structural level of a protein least affected by a disruption inhydrogen bonding is the(A) primar...

A: The proteins are considered as macromolecules that possess structure that are primary, secondary, te...

Q: Which of the following is a consequence of biologicalmagnification?(A) Toxic chemicals in the enviro...

A: The biological magnification refers to the buildup of toxic substances per unit organism weight with...