Q: Replication of DNA requires a primer to initiate DNA synthesis because DNA polymerase can add new…
A: DNA replication is the process by which new DNA is produced from the old DNA in the…
Q: Which of the following is not one of the principles for creating an enriched environment? Human and…
A: Answer :- Option (A) is correct. - Human and non-human environment.
Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…
A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…
Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…
A: Let suppose the coat colour is controlled by the gene A, As there are many traits for the coat…
Q: When the anticodon on a tRNA is "ICG, all of the following codons except can pair with this…
A: Some tRNA anticodon loops contain inosine (I) which allows recognition of multiple codons through…
Q: Although most salamanders have four legs, a few species that live in shallow water lack hind limbs…
A: Natural selection refers to the evolution of species in such a way that the changes are better…
Q: a. Identify the following elements on the diagram. Aminoacyl site (A) Peptidyl site (P) Exit site…
A: During translation, a ribosome contains 3 different RNA binding sites: A site is an aminoacyl or…
Q: how much nuclear DNA in picograms is present in a skin cell during anaphase?
A: DNA is the genetic material present indide the nucleus of each of the cells in the eukaryotic body.…
Q: Describe the most significant hormones responsible for sex differentiation. List the most important…
A:
Q: The annual flu shot is composed of either live attenuated influenza virus or influenza subunits (the…
A: The shots of flu can be given in several forms, such as: Needle-free vaccine. Nasal spray. High…
Q: When SARS-CoV-2 replicates in cells, mutations can occur in the virus’s genome. When mutations have…
A: Mutation The replacement of one nucleotide base with other nucleotide base is known as mutation.
Q: My Diagnosis for Patient C Sex: Chromosomal Disorder: Justification:
A: Karyotype can be defined as a numbers ;size and shape of metaphase chromosomes.It involves the…
Q: Reproduction is usually sexual with both male and female sexes, however asexual reproduction does…
A: Asexual and/or sexual reproduction are used by animals to make offspring. Both systems have benefits…
Q: Explain about dideoxy chaintermination sequencing ?
A: Dideoxy chain termination method is also called as Sanger sequencing. This method can be designed…
Q: Which condition, aerobic or anaerobic, yields more energy (ATP) ?Why do you think this is ?
A: Respiration It is amphibolic and exergonic cellular process. Multistep enzymatic process. Metabolic…
Q: Why do signals indicating damage to cells result in increase in the expression of p21Cip1?
A: P21cip1 is small 165 amino acid protein that mediates p53 dependent G1 growth arrest.
Q: Which statement is NOT a key recommendation according to the current Dietary Guideline? Select one:…
A: Dietary guidelines provide advice on what to eat and drink for a healthy lifestyle. These help to…
Q: One type of epithelial tissue can convert into another under certain abnormal conditions. Give two…
A: Introduction :- The epithelium is a type of body tissue that forms the covering on all of your…
Q: 2. Label the figure of the eye shown to locate anterior cavity, posterior cavity, anterior chamber,…
A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer…
Q: What did genera discussed the Staphylococcus? Are the healthcare concerns, infections, and…
A: the genus is divided into the two species Staphylococcus aureus and S. albus. Zopf (1885) placed the…
Q: During bacterial RNA chain elongation, ____ proceeds ahead of the transcription bubble introducing…
A: RNA chain elongation is called transcription. When transcription occurred in the transcription site…
Q: 6. Consider the following biochemical pathway: precursor compound I enzyme enzyme A В compound II…
A: The fungus Neurospora was used by Beadle and Tatum to manipulate the biochemical outcomes of…
Q: Reproduction is usually secual with both male and female sexes, however asexual reproduction does…
A: Reproduction can be divided into two categories. One of the categories include asexual reproduction.…
Q: Helping tags: Biology, microbiology, food microbiology, lactic acid bacteria, fermentation 1. You…
A: A starter culture is a type of microorganism or consortium of microorganism that initiates the…
Q: Identify one Filipino scientist, Research on his contributions in the field of science, make a brief…
A: A biologist is a scientist who does biological study. Whether that's a single cell, a multicellular…
Q: b. What is the average charge of the amino acid at a pH of 10? Please round your answer to the…
A: The isoelectric point is the point at which amino acids carry no net charge.
Q: What are taxonomic aids? Mention some of the taxonomic aids for identification.
A: Taxonomy is the science of naming, describing, classifying organisms. The father of Taxonomy is Carl…
Q: Some eukaryotic promoters contain an element positioned around nucleotide +1 called a…
A: The transcriptional initiator (Inr) for mammalian RNA polymerase II is a DNA sequence element that…
Q: why are apples green red and yellow
A: Introduction :- Apple (Malus domestica), one of the most widely grown tree fruits, is the fruit of…
Q: What are some of the advantages and disadvantages of utilizing insects as experimental animals in…
A: In various toxicological studies such as in drug toxicity analysis etc. using an insect as an…
Q: Which group of animals have endoskeletons? Annelids and Mollusca Cnidaria and Ctenophora O Nematoda…
A: Endoskeleton is internal bone or cartilage structure of animals which have a vertebra and some…
Q: What seems to be the function of the spindle fibers ?
A: Spindle fibers are a network of threads like filaments that are forms during the cell division…
Q: 9. Which of the following statements best explains the Theory of Natural Selection? * A. Organs…
A: 9) Natural selection can be defined as the phenomenon in which only those organisms survive in the…
Q: If you discover new bacteria from the sands of Culebra's beaches that have the ability to degrade…
A: Although biochemical techniques have only identified a small number of plastid proteases,…
Q: How do mitochondrial proteins interact with IAPs to prevent inhibition of apoptosis?
A: Multicellular organisms experience apoptosis, which is a type of programmed cell death. Cell death…
Q: Let's Apply In each of the following DNA sequences, write on your answer sheet the corresponding…
A: DNA ( Deoxyribonucleic acid ) is two stranded helical structure which act as genetic material in…
Q: Why has the American medical profession risen to itspresent heights?
A: Medical profession is field which provides health care services to patient.like pharmacy, hospital,…
Q: Following the arrival of an action potential in stimulated cells, synaptic vesicles rapidly fuse…
A: Action potential Is an instantaneous, fast, temporary, and spreading change in the resting membrane…
Q: Design a laboratory protocol to develop a monoclonal or polyclonal antibody against a protein of…
A: Antibodies, also known as immunoglobulins, are protein molecules produced by the body's immune…
Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…
A: To Determine the genotypic and the phenotypic ratios of the offspring if the guinea pigs have coat…
Q: PROCEDURE 1 Time to Trace! In this procedure, you will be tracing two invaders: bacteria in the…
A: Bacteria are microscopic, single-celled organisms that exist in their millions, in every…
Q: Which series is arranged in order from largest to smallest? Chromosomes, nucleus, cell, DNA,…
A: Introduction The cell is the smallest unit that can live on its own and that makes up all living…
Q: Consider a person without any functioning plasma cells. What effects would this condition have on…
A: Plasma cells are round or ovoid cells that contain colored cytoplasm with a pale perinuclear area of…
Q: How can the heart be strong enough to pump blood up your legs against gravity?
A: The heart is incapable of pumping blood back up the veins in your legs and back to your heart on its…
Q: 4. The pre-mRNA encoded by the gene for calcitonin undergoes alternative processing to yield two…
A: Alternative splicing of precursor mRNA is an essential mechanism to increase the complexity of gene…
Q: List two ways you think would minimise or avoid lag phase of microbial growth
A: During lag stage, the bacteria can adjust to development conditions. It is the period where the…
Q: The increase in air CO2 concentration leads to global warming and extreme weather. What are the…
A: C4 species, the photosynthesis is nearly saturated under recent ambient [CO2] von Caemmerer, It has…
Q: List and describe three changes in muscles that occur duringendurance training and explain how each…
A: Three changes in muscles that occur during endurance training are: a slower utilization of…
Q: 9. a. What fossil primate possesses traits of both anthropoids and hominoids? b. What are those…
A: Hominid is a sort of primate that has a place with the family Hominidae. In scientific…
Q: 4. The newly synthesized DNA strand during replication was made from the 5' to 3' direction. 5. The…
A:
Step by step
Solved in 2 steps
- 1. Select one product of anaerobic respiration or fermentation.2. It should include the following: a. Description of the Product b. Method/ Process of Creating the Product c. Uses/ Importance of the ProductDescribe the characteristics of alcohol fermentation and lactic acid fermentation.Bacterium F had the lab results below. What can you tell me about the carbon food sources it ferments and the kind of end products it produces in anaerobic respiration? View attached photo.
- what does a negative result mean in an oxidase test?Select all that applies a)The bacteria may undergo anaerobic respiration b)The bacteria may have a cytochrome C oxidase c)The bacteria may undergo aerobic respiration d)The bacteria will not have cytochrome C oxidase e)None of the anwers are correctExplain how the microbe in your selected food undergoes fermentation biochemically speaking, and how does this impacts the food quality? The example I chose for the fermented food is Yogurt.I need help with Carbohydrate fermentation! Please indicate if each organism ferments the carbohydrate. indicate whether or not the phenol red indicator changes color and if it will produce gas. Organisms: Escherichia coli Alcaligenes faecalis Staphylococcus epidermidis Proteus vulgaris Carbohydrates: - glucose - lactose - sucrose Choose between the following results: Acid (yellow)/ no gas Acid (yellow)/ gas No acid (fuschia)/ gas No acid (fuschia)/ no gas.
- TRUE or FALSe anaerobic fermentation of pyruvate occurs in the mitochondria I chose TRUE and was marked incorrect. Explain how false is the correct answer so i can better understandI need to find two gram positive and two gram negative pathogenic bacteria that may be classified as being facultative anaerobes. What tissues or organs do these bacteria target in the human body? Why is it to their advantage to be able to use either aerobic respiration or anaerobic respiration/fermentation?Could I please get help with this discussion post. Compare and contrast aerobic respiration, anaerobic respiration, and fermentation.
- Explain the metabolic changes found in denitrifiers, compared to microorganisms doing aerobic respirationSelect ALL that apply. An organism that can undergo fermentation could possibly be an Obligate Aerobe Obligate Anaerobe Facultative anaerobe Aerotolerant anaerobediscusses an important practical application of fermentation.