A 19-year-old woman comes to the physician because of a 1-month history of mild fatigue and weakness. Physical examination shows no abnormalities. Her hemoglobin concentration is 11 g/dL and mean corpuscular volume is 74 μm3. Hemoglobin electrophoresis shows 10% HbA2 (N < 3.5). Which of the following is the most likely diagnosis?   A.Beta thalassemia minor   B.Hemoglobin Barts disease   C.Alpha thalassemia minima   D.Hemoglobin H disease   E.Sickle cell trait

Q: How do I make a Calibration plot with this?

A: Graphs or plots are generally used to organize the data. It also helps to tell the relationship…

Q: What particular pathways or enzymes appear distinct for sulfate reducing bacteria in order to…

A: INTRODUCTION : Sulfate reducing bacteria - It is a type of bacteria which can reduce sulfate.They…

Q: Explain how the process of translation takes place. Use the following terms in your answer:…

A: Introduction: The process of polymerization of amino acids that results in the formation of a…

Q: Both the isolation buffer and assay buffer that was used in isolation of mitochondria contained 0.3M…

A: The purpose of using mannitol at this concentration in isolation buffer  and assay buffer to…

Q: Explain how Creighton and McClintock’s experiments involving a strain of corn with an abnormal…

A: The chromosomal theory of inheritance states that "chromosomes" behaves as the "carriers" of…

Q: What is the best anticoagulant for blood? Explain

A:

Q: What are the precautions that should be observed in creatinine measurement?

A: A creatinine blood check measures the extent of creatinine withinside the blood. Creatinine is a…

Q: Outline the specific differences in the pelvis and the femur that are associated with bipedalism in…

A: Introduction :- When an organism uses its two back limbs or legs to travel on land, this is known as…

Q: Experiment Mouse injected with type S Mouse injected with type R Mouse injected with dead type S…

A: According to our guideline we can answer only the first question (up to there subparts). All the…

Q: Describe the key physiological basis explaining how cellular senescence contributes to ageing.

A: Cellular senescence is a key physiological that leads to aging. This is supported by evidence in…

Q: Give 4 points of difference between pre-load and after-load.

A: Introduction: One of the metrics used to determine how much blood each ventricle pumps out with each…

Q: Question 24 Proteins can move, twist and even walk, how? By hydrolysing a phosphate from ATP causing…

A: Introduction :- Large, intricate molecules known as proteins play a variety of vital functions in…

Q: Which is a factor that can determine a person's skin color? Genetic O Environmental O Physiological…

A: Although there are several elements that affect skin colour, melanin is by far the most significant.…

Q: You are viewing a new organism at 1000x. You calculated that 1 O.U. =1.3um. It is 8O.U. long How…

A: Microscope is an instrument use to view these organisms that cannot be visualise as such through…

Q: 1. Why does mold growth not measured turbidimetrically? Explain this comprehensively and please, do…

A: Mold belongs to the zygomycetes class of fungi. They are saprophytic in nature that commonly grows…

Q: The post-translational OA. is performed by OB. is removed by phosphatases. OC. can activate or in…

A: Translating a code simply involves changing it from genetic code to proteins. The initiation and…

Q: A fungal disease such as athlete’s foot might be “taken care of” by what immune responce?

A: A fungal disease is a disease caused by a fungus. It will invades the tissue and can cause a disease…

Q: Which of the following is correct with respects to Liverworts, Mosses, and Hornworts? a. They are…

A: Introduction: The science of taxonomy is concerned with the identification, description, and…

Q: You have just started a rigorous exercise. Explain two different ways you can increase blood flow to…

A: Everyone requires physical activity and should be permitted to participate in their chosen…

Q: Discuss the importance of international agreements in the management of biomedical waste

A: Biomedical waste: It is any waste that is generated during the diagnosis, treatment, and…

Q: Xanthoproteic test is used to detect amino acids containing an  aromatic nucleus in a protein…

A: Introduction  Organic substances known as amino acids have both functional groups for amino and…

Q: Prokaryotes were the major life form on Earth for about three Decades Million years Centuries…

A: An entity which is alive, like plants and animals, is referred to as a life form. Over five billion…

Q: How is biological sex determined?

A: As a result of sex determination, people acquire traits that enable them to be classified as males,…

Q: How does translation compare to transcription and DNA replication?

A: Translation  Is the process where the rna produced by transcription is translated into its…

Q: Why the microorganisms in the hay infusion are not stained?

A: Hay infusion :- It is dry plant based materials (grass, leaf litter) which is used to grow…

Q: Molecules transported in the fast phase of axoplasmic transport are:  Select all correct answers.…

A: Axoplasmic transport occurs in neurons. It is the transport by which proteins and other substances…

Q: Why is it difficult to directly observe succession in most ecological communities? BIUG 14 >

A: Ecological succession is the mechanism of transformation in an ecological community's species…

Q: What is B cell selection?

A: B Cell Selection: B Cells are the immunogenic cells, which are a type of lymphocytes or white blood…

Q: our raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3'…

A: A) One Sequence Read as per data: GTTACGCTTAGA B) One Sequence Contig: ACCGTCGGTTACGCTTAGATAACAAG

Q: What happens when two amino acid molecules form a bond to build a protein? release of a carbon…

A: Introduction: Protein; Amino acids are arranged in a long chain and joined to one another by…

Q: A brief intrwhich introduces ALP as a diagnostic tool in cancer and create  a Graphical Abstract to…

A: ALP:- it is an enzyme known as alkaline phosphatase. It's level was founded to increase in many…

Q: Calculate N+1 for this non-continuously reproducing population of weird bugs that live on a planet…

A: Given information It is a non-continuously reproducing population. No= 1000 Ro (reproductive rate)=…

Q: What are the neurotransmitters  that bind to ionotropic channels and allow for cation influx? Select…

A: The signalling process cannot operate without chemical messengers called neurotransmitters. They are…

Q: Most of the time of the cell cycle is spent in prophase s-phase mitosis anaphase II none of the…

A: Introduction :- A cell's growth and division are accompanied by a sequence of processes known as a…

Q: In detail describe cyclic and non cyclic photophosphorylation, include all the steps

A: Photosynthesis is a metabolic process in which glucose and oxygen is synthesised from the…

Q: why are the steps in gram staining are so carefully standardized?

A: Gram staining is very useful process that differentiate bacteria on the basis of their cell wall…

Q: Compare the appearance of the "e" when viewed with the naked eye to its appearance when viewed under…

A: Introduction: - Microscopes are optical devices used to magnify an object. They are commonly used in…

Q: Would 1 change of xylene for 20 minutes be superior to 2 changes of xylene for 10 minutes each in…

A: Xylene is a volatile liquid hydrocarbon obtained by distilling wood, coal tar, or petroleum, used in…

Q: True/False: The small subunit of a ribosome catalyzes the formation of the peptide bonds that link…

A: Introduction: An mRNA molecule is attached to by a little ribosomal subunit during translation. A…

Q: The word root erythr/o means?

A: We know that it is crucial for people to comprehend terminology particular to their chosen vocation.…

Q: You have been put in charge of managing a population of the endangered pink fairy armadillo. The…

A: We know that  Nt = No*2ñ  Nt is population after time t  No is initial population  n is time taken…

Q: 1. Carbon dioxide +Water+ Energy → Sugar + Oxygen 2. Sugar + Oxygen → Water + Carbon Dioxide +…

A: Cellular Respiration:  The process of cellular respiration involves the oxidation of biological…

Q: 4. What color would the bacterial cells have when viewed microscopically after the following…

A: The bacteria cell is a prokaryotic organism. It has nucleoid in place of nucleus. The membrane bound…

Q: Draw the pathway new viruses must use to exit the cell. Start with the virus near the nucleus and…

A: Virus:  A microscopic particle that can multiply inside the host organisms is called a virus. They…

Q: Which characteristics would you expect to be indicative of horizontal gene transfer? T / F A…

A: Genetic material between different bacterial species or cells can be done via Horizontal gene…

Q: What is endosymbiosis?

A: Introduction :- Endosymbiosis is a symbiotic connection in which one organism lives inside the…

Q: What enzyme has to bind to DNA for transcription to begin

A: Introduction Transcription is the process of transcribing data from a DNA strand into a brand-new…

Q: Below is a table that lists the labeled autosomal genes for this female karyotype. Select the…

A: The question is asking about the genotypes and phenotypes of the MCR-1 gene, LDLR gene, and ABO…

Q: Which organisms in this food web would be strictly classified as primary consumers?

A: Primary consumers make up the second level of the food chain and are herbivores, they feed on…

Q: airways clean. ribosomes cell walls cilia vacuoles microvilli present on the cells of our trachea…

A: Explain;- Cilia line the trachea as well, removing foreign particles and fluids from the airway and…