(A) ACTIVATING (B) ACTIVATING INPUT INPUT GENE X GENE X GENE Y GENE Y GENE Z GENE Z (C) ACTIVATING LL (D) ACTIVATING INPUT INPUT GENE X GENE X GENE Y GENE Y GENE Z GENE Z Figure Q8-5 Network motifs composed of transcription activators and repressors (Problem 8-17).

(A) ACTIVATING (B) ACTIVATING INPUT INPUT GENE X GENE X GENE Y GENE Y GENE Z GENE Z (C) ACTIVATING LL (D) ACTIVATING INPUT INPUT GENE X GENE X GENE Y GENE Y GENE Z GENE Z Figure Q8-5 Network motifs composed of transcription activators and repressors (Problem 8-17).

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 8TYU: Through alternative splicing, eukaryotes (a) reinforce gene inactivation (b) prevent transcription...

See similar textbooks

Related questions

Q: 1.Explain how type B intercalated cells increase the acidity of the blood (figure above). 2. How…

A: Introduction Blood is a bodily fluid found in the circulatory system of humans and other animals…

Q: Most of the carbon dioxide we exhale is produced in: A) glycolysis. B) photosynthesis in the…

A: Aerobic respiration is an enzymatically controlled release of energy in a stepwise catabolic process…

Q: Characterize bacteriophages.

Q: A. pleura B. peritoneum C. mucosa D nericardium

A: A pleura is an a double serous membrane that bends up on itself to produce a pleural sac. The serous…

Q: The concept of endosymbiosis as applied to chloroplast and mitochondria found in eukaryotes: a) is…

A: Endosymbiosis is a kind of relationship in which one organism enters in an another organism. The…

Q: A socioeconomic impact refers to a change in a community's access to or use of income, food, clean…

A: what is mulch based cropping? seeding mulch-based editing (DMC), as an elective to customary…

Q: Give a brief description of a typical eukaryotic cell cycle, indicate during which phase DNA…

A: * cell cycle consists of four phases . They are G1 phase S phase G2 phase M phase * During G1…

Q: The glycolytic enzyme pyruvațe kinase is activated by dephosphorylation and inactivated by…

A: Pyruvate kinase It is an important enzyme of glycolysis that aids in the conversion of…

Q: Evolution of what biological process is hypothesized to have been made possible by the appearance of…

A: Introduction :- Chlorophyll is a group of green pigments found in the mesosomes of cyanobacteria and…

Q: Discuss the operation of Na+ - K+ pump in further detail (2 pages including a few figures, if…

A: * The sodium potassium pump can be found in many cell plasma membranes which can be Powered by ATP…

Q: Select all that apply to root-associated fungi a. arbuscular mycorrhizal fungi cross the plant…

A: Soil is a thin layer of matter that forms on the earth's surface as a result of the processes such…

Q: how many different proteins composed of 100 amino acids could possibly exits?'

A: A protein molecule is made up of a monomer which is known as amino acid. So we can say the amino…

Q: calculate the narrow sense heritability of height between aunts and nieces if the obscured phenotype…

A: Introduction :- Animals with high values for one phenotype also tend to have high (or low) values…

Q: The cell cycle of eukaryotic cells include what 2 phases

A: Introduction :- Most cells have four synchronised processes in their division cycle: cell growth,…

Q: Neuronal control of macrophage function in acute disease like septic shock in mice involves each of…

A: The correct option is - vagal signals are transmitted via acetylcholine that binds alpha 7 nicotinic…

Q: Adoptive transfer of macrophages from depressive mice to induced inflammatory markers and increased…

A: As we know depression is common in people with inflammatory bowel diseases (IBD), But the mechanism…

Q: What is sere?

A: Ecological succession: The mechanism whereby the mix of species and environment in a given area…

Q: The extra energy required for the evolution of the highly complex eukaryotic cell was possible…

A: A cell is composed of several cell organelles. Besides the nucleus, mitochondria and chloroplasts…

Q: You are a legislator in a nation with no endangered species act. You want to introduce a law to…

A: Extinction is the extinction of a species or group of taxa. The death of the last member of a…

Q: Reaction Primary Use Ezyme Phosphatases DNA ligases DNA polymerase I Thermostable DNA polymerases

A: Enzymes are proteins that aid in the acceleration of metabolism, or the chemical reactions occurring…

Q: Discuss the following statement: “We wouldhave no idea today of the importance of insulin as a…

A: Introduction Insulin aids the entry of blood sugar into the body's cells, allowing it to be utilised…

Q: How to prepare an agar plate for bacteria? How to include the antibiotics into agar plates? How long…

Q: List the four traits that define chordates.

A: Chordates include all those animals that contain vertebral columns and they belong to the phylum…

Q: Which of the following is a FALSE statement regarding human chromosomes? A. The chromosome…

A: Introduction :- Chromosomes are threadlike structures made up of protein and a single molecule of…

Q: Gregor Mendel followed specific steps when breeding pea plants to determine the underlying cause and…

A: Mendel’s seminal work was accomplished using the garden pea, Pisum sativum, to study inheritance.…

Q: 3. One indication of the relative importance of various ATP-producing pathways is the Vmax of…

A: I gave you the answers below.

Q: Describe the difference between carrier proteins and channel proteins. What is required for the…

A: * The channel proteins are proteins that have ability to form hydrophilic pores in cell membranes…

Q: B. Classify the flowers whether they are regular or irregular, complete or incomplete. Observe and…

A: The external morphology of plants helps in distinguishing them from other plants. The flowers of the…

Q: Select all that are true regarding the rhizosphere and rhizobacteria. a. the rhizosphere is the…

A: Introduction An ecosystem deals with both biotic and abiotic factors and their interaction with…

Q: theory of inheritance states that genes are on chromosomes. Therefore, any chromosomal abnormality…

A: Chromosomes- these are the structure that is present in the nucleus of cell. In simple words you…

Q: Explain how GEF and GAP activate and deactivate RAS, respectively.

A: GEFs and GAPs are multidomain proteins that are regulated by extracellular signals and localized…

Q: Give three examples of each biotic interaction, specifically mutualism and predation. Please explain

A: Biotic interaction Biotic interaction is a kind of interaction where organisms living in same same…

Q: Individuals with XYY chromosomes are said to be "supermale". Which of the following is FALSE…

A: Humans are said to have 23 pairs of chromosomes which makes a total of 46 when the cells are normal.…

Q: In which meiotic division does the separation of the homologous occur? What are the ploidies of the…

A: Introduction The production of offspring by sexual reproduction includes the fusion of two gametes,…

Q: The binding between the substrate and the active site of the enzyme: O Is very specific O Resemble…

A: Enzyme is a biocatalyst. It speeds up the reaction.

Q: Briefly describe why there could be a possible link between TAS2R38 sensitivity and obesity. In your…

A: Aim : *To study the TAS2R38 bitterness receptor variation implications in obesity prevention and…

Q: Twenty snakes with the Aa genotype migrated to a population of 80 snakes of the same species with…

A: If the population is in Hardy-Weinberg equilibrium, the genotype frequencies should be 0.49 for AA,…

Q: A bird populations is surveyed for variation at four loci. The number of alleles per (1) locus is…

A: Percentage loci polymorphism It predicts the genetic diversity of a given population and can be…

Q: Explain and give insight why the use of a face shield protect us against COVID 19, and now it is no…

A: The face shield is a transparent kind of plastic and can be remolded to produce transparent glass…

Q: Almost all of the known species of the taxa Archea have been identified through cultivation in a…

A: The culturable as well as organisms of archae that are well investigated belongs to the species of…

Q: True or false: The age-related decline in naive T cells affects BOTH the innate and the acquired…

A: Introduction Immune cells emerge from bone marrow stem cells to become several types of white blood…

Q: Giardia lamblia enters a human or other host in what form? O a) trophozoite Ob) spore O c) endospore…

A: Protozoans are group of organisms that possess single cell and are eukaryotic . They are classified…

Q: If you inhibit the closing of sodium channels what do you predict the effect on neuronal function…

A: Action potential in neuron is the direct consequence of voltage gated sodium channel. During the…

Q: Put the following steps for the outline of the growth factor signaling pathway in order: Map Kinase…

A: Activities with constant changes in the environment. In doing so, organisms use a number of pathways…

Q: What are some of the Select 2 correct answer(s) Decreased central nervous system activation Improved…

A: Neural adaptations to exercise include: - Improved efficiency in neural recruitment patterns…

Q: If FOV is 5 mm and the number of cells in FOV is estimated at 35, what is the cell size in mm? In…

A: Field of View = Field Number (FN) ÷ Objective Magnification.

Q: What are the "chiasms" of homologous chromosomes seen in prophase I?

A: Introduction Chromosomes are the condensed form of chromatin present in the nucleus of the cells.…

Q: Acclimatization is adaptations in a lab-controlled setting. True False

A: Acclimatization is the beneficial physiological adaptations that occur during repeated…

Q: Neutrophil is a common White blood cell present in blood and the percentage of presence is: O 15% O…

A: Neutrophils are the most numerous white blood cells and it is an important part of our immune system…

Q: The Prokaryotes are associated with the following structures EXCEPT: A) ribosomes, B) Lysosomes and…

A: * prokaryotes are organisms they lack nucleus and other organelles. *Prokaryotes are divided into…

Concept explainers

Emotions

Emotions are biologically based psychological conditions caused by neurophysiological changes which are linked to different factors such as thoughts, emotions, behavioral responses, and pleasure or displeasure. These emotions are not similar to moods. The mood is an affective state. Mood depends upon several factors, such as weather, the environment, physiology, etc. Emotions can be beneficial or detrimental depending on the situation. Emotional reactions are simple. Emotional well-being is strongly affected by our well-being, and such feelings are private.

Question

Examine the network motifs in Figure Q8–5.
Decide which ones are negative feedback loops and which
are positive. Explain your reasoning.

(A) ACTIVATING
(B) ACTIVATING
INPUT
INPUT
GENE X
GENE X
GENE Y
GENE Y
GENE Z
GENE Z
(C) ACTIVATING
LL
(D) ACTIVATING
INPUT
INPUT
GENE X
GENE X
GENE Y
GENE Y
GENE Z
GENE Z
Figure Q8-5 Network motifs composed of transcription activators and
repressors (Problem 8-17).

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Name the lambda promoters whose expression is regulated by the cro protein. For each promoter you named, is cro an activator or a repressor of transcription from that promoter?
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
1. Trithorax group proteins silence genes by* a. trimethylating histone 3 at lysine residue 2. b. trimethylating histone 4 at lysine residue 2. c. trimethylating histone 3 at lysine residue 4. d. trimethylating histone 4 at lysine residue 4. 2. Bonding of which ligand does NOT result to transcription activation?* a. fibroblast growth factor b. jagged protein c. TGF-β family d. Wnt family
4.1 Name and discuss two transcription regulatory elements that can be found in the figure. (6)4.2. During the activation of eukaryotic transcription the promoter region needs to be accessible for the binding of transcription factors. Describe in detail one of the mechanisms involved in this process.
How do I draw the sequence and explain the process for each step? Draw the sequence of molecular events that occurs to induce STAT transcription factor localization to the nucleus. To complete this, you will draw the first step that occurs, then draw a new figure with the second step that occurs, then draw a new figure with the third step that occurs, and so on until you have completed all of the steps. On the drawing, briefly label each molecular event (each drawing). For this brief label, explain what is happening during each step.
In eukaryotes, transcription initiation involves enhancersequences located far from the promoter. In addition, thechromatin of eukaryotic chromosomes must be unwoundto allow access by _________?
Select all of the processes that could be involved in a transcriptional repressor leading to decreased gene expression. a. chromatin remodelling complex responds to tail modification by removing nucleosomes . b. transcription factor binding attracts acetyltransferase enzymes . C. transcription factor binding attracts deacetylase enzymes . D. chromatin remodelling complex responds to tail modification by shifting nucleosomes to a denser grouping. E. DNase cuts the exposed DNA to prevent transcription initiation F. RNA polymerase is unable to recognize the promoter because of the dense chromatin configuration
Define about transcription activator-like effector nucleases (TALENs) ?
67RNA interference was first discovered in Drosophila melanogaster. Yesorno 68Which of the following is required for the bacterial ribosome complex to disassemble?A.EF1A-GTPb.Signal sequencec.Release factorD.EF1B 69A transcription unit must have an initiation signal called a _____________ for accurate and efficient transcription to take place. A.transcription start siteb.promoterc.transcription initiation factorD.ori
Methylation of H3K9 by itself silences genes, but if H3K4 and H4K20 are also methylated, the combination of modifications stimulates transcription. What conclusions can you draw about this?
1. enzymes that catalyze histone acetlation are closesly associated with transription factors, which are proteins that promote transcription. why is this a good biochemical strategy? 2. sp1 is a sqeuence specific human DNA binding protein that binds to a region on the DNA called the GC box, a promoter element with the sequence GGGCGG. Binding of Sp1 to the GC box enhances RNA polymerase 2 activity 50- to a 100 fold. How would you use affinity chromatography to purify SP1?
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Is this terminator rho independent or rho dependent?