Consider the following proposal:People with genetic abnormalities should not bediscouraged from having families. Doctors shouldattempt to treat every genetically related healthproblem and to keep people alive at all cost.If this proposal were initiated, there would be manyeffects on our society. Describe three ethicalmedical technologies that would reduce thefinancial costs created by initiating this proposal.Evaluate the proposal from both a genetic and amoral point of view.Your response should include the followinginformation:• A description of three medical technologiesthat are ethical and that would likely reducesome of the financial costs created byinitiating the proposal• A balanced argument for and against theproposal from the scientific perspective of ageneticist• A balanced argument for and against theproposal from the perspective of a policymaker (eg. a politician or a religious leader Use the following information to answer the nextquestion.In the 19th century, individuals who were notamong the "normal" population were often thoughtto be failures or defectives. Early in the 20thcentury, the interaction of genetics, law and societyresulted in policies of enforced sterilization,restrictive immigration, and institutionalization ofthose thought to be genetic defectives. As thiscentury closes, society will haev difficult choicesto make about the legality, morality, and economicsof applying genetic knowledge and technology.The difficulty of this situation is summarized in thewords of a famous geneticist, TheodosiusDobzhansky (b. 1900 - d. 1975)"If we enable the weak and the deformed to liveand produce more of their kind, we face theprospect of a genetic twilight (decline). but if welet them die or suffer when we can help them, weface the certainty of a moral twilight."

The study of genetics is an interdisciplinary field that includes the systematic study of issues…

Answered: • A description of three medical…

• A description of three medical technologies that are ethical and that would likely reduce some of the financial costs created by initiating the proposal

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 7QP

See similar textbooks

Similar questions

For each of the following genetic topics, indicate whether it focuses on transmission genetics, molecular genetics, or population genetics. a. Analysis of pedigrees to determine the probability of someone inheriting a traitb. Study of people on a small island to determine why a genetic form of asthma is prevalent on the islandc. Effect of nonrandom mating on the distribution of genotypes among a group of animals d. Examination of the nucleotide sequences found at the ends of chromosomese. Mechanisms that ensure a high degree of accuracy in DNA replicationf. Study of how the inheritance of traits encoded by genes on sex chromosomes (sex-linked traits) differs from the inheritance of traits encoded by genes on nonsex chromosomes (autosomal traits)
Bloom syndrome is an autosomal recessive disease that exhibitshaploinsufficiency. A recent survey showed that people heterozygousfor mutations at the BLM locus are at increased risk of colon cancer.Suppose you are a genetic counselor. A young woman is referred to youwhose mother has Bloom syndrome; the young woman’s father has nofamily history of Bloom syndrome. The young woman asks whether sheis likely to experience any other health problems associated with herfamily history of Bloom syndrome. What advice would you give her?
Match the genetic disorder to the descriptions below: Edward Syndrome Jacob Syndrome Patau Syndrome Turner Syndrome Prader-Willi Syndrome Down Syndrome (trisomy) Klinefelter Syndrome Cri du Chat 18-Q Deletion Syndrome Translocation Down Syndrome ________ deletion of part of the P arm of chromosome 5. Improperly developed larynx causes cat-like cry until age 2. IQ is under 20. ________ deletion of Q arm of chromosome 15. Affected individuals have a small head, are retarded, and exhibit bizarre behavior. ________ deletion of Q arm of chromosome 18. Affected individuals have thirteen pairs of ribs (normal is 12 pairs) and IQ under 30. ________ extra 21st chromosome attaches to chromosome 14. Affected individ- uals exhibit epicanthic folds of eyelids, simian crease in palms, and retardation. ________ trisomy 18. Affected individuals…
What type of database is OMIM? https://omim.org/ A.OMIM is an weekly editorial that presents information on new genetic disorders.B.OMIM is database of all genetic disorders linked to the Y-chromosome.C.OMIM is a podcast on herbal remedies that promotes good omens.D.OMIM is an online database that has information on human genes and genetic disorders
Click on the link: https://www.dailymail.co.uk/news/article-4168946/Mum-world-s-black-woman-two-white-babies.html#ixzz4hvs1FUeM.Links to an external site. This case explores how skin color is inherited in humans, presented in the story of Catherine and Richard Howarth whose children are surprisingly light skinned compared to their Nigerian mother. Based on what you have learned about polygenic inheritance, explain how Richard and Catherine Howarth were able to produce light-skinned babies. Are the odds indeed 1 in a million? Include possible genotypes of the couple and their children to support your argument.
As genetic testing becomes widespread, medical records will containthe results of such testing. Who should have access to thisinformation? Should employers, potential employers, or insurancecompanies be allowed to have this information? Would youfavor or oppose having the government establish and maintain acentral database containing the results of individuals’ genomescans?
Clinical or phenotypic heterogeneity, in which different mutations in a gene may result in different phenotypesTRUE oR FALSE ASAP NO EXPLANATION NEEDED
Make a list of the benefits that may arise from genetic testing as wellas possible negative consequences. Discuss the items on your list.
Six months pregnant, an expectant mother had a routineultrasound that showed that the limbs of the fetus wereunusually short. Her physician suspected that the babymight have a genetic form of dwarfism called achondroplasia,an autosomal dominant trait occurring with a frequency of about1 in 27,000 births. The parents were directed to a genetic counselorto discuss this diagnosis. In the conference, they learnedthat achondroplasia is caused by a mutant allele. Sometimes itis passed from one generation to another, but in 80 percent ofall cases it is the result of a spontaneous mutation that arisesin a gamete of one of the parents. They also learned that mostchildren with achondroplasia have normal intelligence and a normallife span. What information would be most relevant to concluding whichof the two mutation origins, inherited or new, most likelypertains in this case? How does this conclusion impact on thiscouple’s decision to have more children?
Six months pregnant, an expectant mother had a routineultrasound that showed that the limbs of the fetus wereunusually short. Her physician suspected that the babymight have a genetic form of dwarfism called achondroplasia,an autosomal dominant trait occurring with a frequency of about1 in 27,000 births. The parents were directed to a genetic counselorto discuss this diagnosis. In the conference, they learnedthat achondroplasia is caused by a mutant allele. Sometimes itis passed from one generation to another, but in 80 percent ofall cases it is the result of a spontaneous mutation that arisesin a gamete of one of the parents. They also learned that mostchildren with achondroplasia have normal intelligence and a normallife span. It has been suggested that prenatal genetic testing for achondroplasiabe made available and offered to all women. Wouldyou agree with this initiative? What ethical considerationswould you consider when evaluating the medical and societalconsequences of offering…
Phenylketonuria (PKU) is a human hereditary disease resulting from the inability of the body to process the chemical phenylalanine, which is contained in the protein we eat. PKU is manifest in early infancy and, if it remains untreated, generally leads to cognitive impairment. PKU is caused by a recessive allele with simple Mendelian inheritance. A couple intends to have children but consults a genetic counselor because the man has a sister with PKU and the woman has a brother with PKU. There are no other known cases in their families. They ask the genetic counselor to determine the probability that their first child will have PKU. What is this probability?
I sequence the DNA of 3 people and see variation in my gene of interest as follows: Person 1: ATGCAACAATTTAATAAT Person 2: ATGCAACGACGACGACGACAATTTAATAAT Person 3: ATGCAACGACGACGACGACGACGACGACGACAATTTAATAAT What is the name for this kind of variation?