A normal cell has no growth factor bound to the growth factor receptor. What do you predict about ERK in this situation? it will activate a transcription factor it will be phosphorylated it will not be phosphorylate it will not go into the nucleus 4

A normal cell has no growth factor bound to the growth factor receptor. What do you predict about ERK in this situation? it will activate a transcription factor it will be phosphorylated it will not be phosphorylate it will not go into the nucleus 4

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter37: The Endocrine System

Section: Chapter Questions

Problem 1VCQ: Figure 37.5 Heat shock proteins (HSP) are so named because they help refold misfolded proteins. In...

See similar textbooks

Related questions

Q: 27) If the sequence TCGTA was used as a template in DNA replication, what would the sequence of…

A: Chromosome is a thread-like elongated structure that contains numerous genes on it. Genes act as…

Q: what are structures and functions of enzymes?

A: Enzymes are catalysts which help in altering and speeding up the rate of reaction without getting…

Q: Continued exposure to addictive drugs causes ______, reduced activity in several frontal lobe…

A: The frontal lobe generally executes high-level cognitive processes in the brain such as…

Q: Give typed full explanation

A: This is a kind of a bone attached to a joint. A large cavity can be identified in this arrangement.

Q: ease select the diseases that are often caused by S. pyogenes. Check All That Apply impetigo…

A: Group A Streptococcus, also known as S. pyogenes, can lead to several illnesses.

Q: Cataracts develops

A: Cataracts:These are the eye conditions which are common where the natural lens of the eye becomes…

Q: How is cigarette smoking related to elastase function? Methionine sulfoxide is formed by cigarette…

A: lastase is an enzyme, specifically a protease, that plays a critical role in the breakdown of…

Q: Question 8 Myoglobin and the subunits of hemoglobin have: O very similar primary and tertiary…

A: Hemoglobin is an iron-containing protein, present on the surface of RBCs and carries oxygen from…

Q: What method did Coghill suggest to produce penicillin?.

A: A number of diseases can be managed and treated using penicillin. It is a kind of antibiotic known…

Q: How many chromosomes are shown in this picture? O 1 1234 O 5 ↑

A: A chromosome is a long, thread-like structure found in the nucleus of a cell. It carries genetic…

Q: cross between two heterozygotes fruit flies with purple eyes and white bodies (EeBb) results in 4…

A: Parent 1: EeBbParent 2: EeBbEye color : EeHomozygous dominant (EE): Purple eyesHeterozygous (Ee):…

Q: Which statement best describes how molecular complementarity enables specificity during a signaling…

A: Cell signalling, also known as cell communication, is a cell's ability to receive, analyse, and…

Q: In the mid-1990s, researchers discovered an enzyme in HIV called protease. Once the enzyme's…

A: The substances that inhibit the activity of enzymes are called enzyme inhibitors and the mechanism…

Q: Acidification of the stomach uses all of the following types of transport EXCEPT: O symporters O…

A: The parietal cells in the proximal two-thirds (body) of the stomach release acid. Gastric acid aids…

Q: Based on these graphs, and assuming head raises of European finches helps watch for predators but…

A: The first graph (a) depicts the relationship between the total head raises of the flock per minute…

Q: This food web represents part of a terrestrial community that is very similar to Millbrook Marsh.…

A: When several interlinking food chains are present in a particular area at a particular time then it…

Q: You are required to select your organisms from four different phyla. You cannot use the same phylum…

A: Phylum Mollusca:Organism: Giant Clam (Tridacna gigas)Taxonomic Structure: Kingdom: Animalia, Phylum:…

Q: QUESTION 2 Most sensory stimuli are interpreted in: 00 the cerebrum sensory receptor cells O…

A: Actin is a crucial protein found in cells, particularly in muscle cells. It plays a fundamental role…

Q: The following sequence alignment shows the point mutation that exists in hemoglobin for some cases…

A: In the field of molecular biology and bioinformatics, the comparison plus the analysis of the…

Q: What behaviors during the egg-laying season might lead to potential behavioral adaptations that…

A: characters During the breeding season,the following behaviors can lead to behavioral changes that…

Q: In transformation, a bacterial cell takes up DNA fragments from its surroundings. The figure shows…

A: Bacteria transform themselves by ingesting DNA from their surroundings. Griffith first outlined this…

Q: Which of the following statements is TRUE about the topologies of the trees shown below? All four…

A: A hybrid network architecture known as a tree topology, or star-bus topology, connects star networks…

Q: The genes for the human type I IFNs lack introns and those those encoding 14 subspecies of IFN-α,…

A: Genes are the part of DNA that undergoes expression and produces RNA. Eukaryotic genes contain both…

Q: edigree and determine which of the following modes of inheri ait: dominant recessive minant essive…

A: A pedigree is made on different modes of inheritance that could be autosomal or sex linked.…

Q: Impulsiveness: A) has been linked to functional and structural changes in the brains of drug…

A: Impulsivity is a complex trait that is influenced by a variety of factors, including genetics, brain…

Q: Evolution results from A. mutations. B. natural selection. C. genetic drift. D. gene flow. E.…

A: It is the change in the characteristics of species over generations. It relies on the process of…

Q: Label the diagram: 3'4 5' Primer 5' 15' '3'

A: The heterocatalytic processes by which a new DNA strand is synthesized on a old DNA template is…

Q: If the clamp loader on DNA Pol III were not efficient at loading the new clamp, which strand of the…

A: DNA Polymerase III is a complex protein involved in DNA replication. It has several subunits,…

Q: Part II. Basic Body Plans Cross Section of Planaria Cross Section of Roundworm

A: A cross section or T. S also known as an axial plane is obtained by dividing the body into head and…

Q: Which of the following is an advantage of confocal microscopy over conventional fluorescence…

A: One significant advantage of confocal microscopy compared to conventional fluorescence microscopy is…

Q: See image

A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: An organism described as 2n=4 has the chromosomes below with genes indicated by letters and…

A: Chromosomal aberration - It is defined as the change in chromosome structure and number.Change in…

Q: is i 5' AACGATGCCATCAGAGCCCAGGACGTGATTTAA TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT Ċ (c) wha 3' 5' se that…

A: Transcription is a process in which mRNA is synthesized with the help of DNA by the help of the…

Q: Write down the energy content in kilo-calories (kcal) from one gram of fat, one gram of carbohydrate…

A: In the context of nutrition and dietary science, it is essential to understand the energy content of…

Q: Draw a diagram/graph to represent the results of an experiment that would prove that there was…

A: Horizontal gene transfer is a method of gene transfer between two unrelated species. Here a…

Q: You are studying the effects of temperature and lipid composition on membrane fluidity using…

A: The cell membrane, also known as the plasma membrane, is a thin, flexible barrier that surrounds the…

Q: Clonal amplification of DNA using microbiological organism faces challenges associated with (check…

A: A solid phase amplification of DNA fragments which helps in development of strong detectable signal…

Q: What codon results in a release factor entering the ribosome? 5' M GPPP-…

A: Translation is a process of formation of protein from mRNA. This process takes place in the…

Q: Determine the % inaccuracy by calculating the percent error of the micropipette at the set volume of…

A: In order to solve the issue, real weight measurements must be compared to the predicted volume using…

Q: Figure 2.25 Ocean acidification. CÓ, HO H₂CO H₂CO₂H+ HCO3 HACO HCOS CO₂ + Ca CaCO₂ Scientific Skills…

A: This question is about interpreting a scatter plot with a regression line from an experiment that…

Q: Tay-Sachs disease causes lysosomes to rupture. How would this affect the cell? Check all that apply.…

A: The nervous system is the main organ affected by Tay-Sachs disease, a hereditary condition. It is…

Q: 15 These are the weakest bonds of all and are sensitive to pH as well as changes in temperature. a.…

A: There are different types of bonds or biological interactions found in living systems. These bonds…

Q: A lima bean contains a plant embryo that is capable of becoming a mature plant with roots, a stem,…

A: The embryo is a diploid structure formed from the fusion of haploid female and male gametes. The…

Q: external lactose 0000 cell membrane RNA polymerase promoter The role of lac permease is to: lactose…

A: In bacteria, the genes that encode the enzymes of a metabolic pathway are usually clustered together…

Q: Analyze the following pedigree and determine the mode of inheritance. Assume that the traits being…

A: The correct answer is option D. Sex-linked recessive.

Q: 6 = W - 1 A 2 C ♦ ( ◆ ♦ N/A (> ◆ ◆

A: In a complementation chart a group will contain similar mutations that failed to compliment one…

Q: 2. How many hydrogen bonds can pyridoxal phosphate (shown below) donate to the surrounding water?…

A: A crucial coenzyme generated from vitamin B6 called pyridoxal phosphate (PLP) functions as a…

Q: Telomeres are at the end of linear chromosomes, and have a characteristic repeat sequence (5…

A: Telomeres are the repetitive nucleotide sequences present at the bottom of the chromosomes.These…

Q: When stained with methylene blue (buccal cell) and haemalum acid (onion cell), the nuclei were the…

A: When stained with methylene blue (buccal cell) and haemalum acid (onion cell), the nuclei were the…

Q: What is the size in µm of a cell that is 135mm wide in my photo? The scale bar in the photo is…

A: A microscope is a scientific instrument that allows us to see objects that are too small to be seen…

Question

A normal cell has no growth factor bound to the growth factor receptor. What do you
predict about ERK in this situation?
it will activate a transcription factor
it will be phosphorylated
it will not be phosphorylate
it will not go into the nucleus
D

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: ERK pathway

VIEW

Step 3: Explanation of incorrect options

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following statements are correct about cell signaling and proliferation in normal cells? more than one answer A. Cells require growth factors from other cells to proliferate B. Growth Factors must enter cell to signal cell growth C. Growth Factor Receptors can be oncogenes D. Protein Growth Factors can be Oncogenes E. Staurosporine is a potent inhibitor of Ser/Thr kinases and would be expected to inhibit Epidermal Growth Factor Receptor signaling
The first step in the action of a growth factor isa. histone unwinding.b. binding to cell surface receptors.c. triggering DNA replication.d. activation of a protein kinase cascade
Which of the following exert their cell signaling ability by directly phosphorylating other proteins? multiple answers A. RAS B. Epidermal Growth factor C. HER2 D. SRC E. Estrogen Receptor
Opiods cause ligand-gated K+ channels to open and move with their concentration gradient from high to low (into or out) Blank 1. Fill in the blank. of the cell, causing the membrane potential to (hyperpolarize or depolarize) Blank 2. Fill in the blank. Fill in the blank using one of the options in the parenthesis
A cell begins to undergo apoptosis due to stress. Which of the following are true about this cell? (select all that apply) The cell can exit apoptosis if the stressful factor is removed The cell has high levels of p53. The cell's DNA will inevitably degrade The cell may undergo mitosis before completing apoptosis
Which of the following exert their cell signaling ability proteteolysis of other proteins? multiple answers A. RAS B. Epidermal Growth factor C. Notch Receptor D. TGF-Beta Receptor E. Estrogen Receptor
What statement about Cdks/Cyclins below is false? A) Cyclins phosphorylate Cdks B) Cdks are kinases C) Cdk expression is constant during the cell cycle D) Cyclin expression fluctuates during the cell cycle E) Cdk activity fluctuates during the cell cycle
The cell is triggered to make insulin when a glucose molecule binds to a receptor on the surface of the beta-cell. This then activates a molecule inside the cell to activate the expression of the gene. This process in which cells communicate with each other is called ___________ pathway (two words).
Quorum sensing is triggered to begin when ___________. a. treatment with antibiotics occurs b. bacteria release growth hormones c. bacterial protein expression is switched on d. a sufficient number of bacteria are present
Protein mutations that result in a hyperproliferative (sustained proliferative signaling/uncontrolled growth signals) cell phenotype can be classified as a__
What is a primary function of tumor suppressor genes?a. stop all cells from dividingb. stop certain cells from dividingc. help oncogenes produce oncoproteinsd. allow the cell to skip certain phases of the cellcycle
Describe what happens to the G1 cell cycle check point of a skin cell that is stimulated to divide by neighboring cells following an injury. Describe the pathway from the growth factor signal to the cell cycle checkpoint regulation of gene expression resulting in cell duplication. Briefly explaining the mechanism