A person has a blood pressure of 145/95. What does the number 145 represent? Select one: O a. systolic pressure due to ventricles relaxing O b. diastolic pressure due to ventricles relaxing O c. systolic pressure due to ventricles contracting O d. diastolic pressure due to ventricles contracting

A person has a blood pressure of 145/95. What does the number 145 represent? Select one: O a. systolic pressure due to ventricles relaxing O b. diastolic pressure due to ventricles relaxing O c. systolic pressure due to ventricles contracting O d. diastolic pressure due to ventricles contracting

Body Structures & Functions Updated

13th Edition

ISBN:9780357191606

Author:Scott

Publisher:Scott

Chapter20: Urinary System

Section: Chapter Questions

Problem 2RQ

See similar textbooks

Related questions

Q: QUESTION 3 DNA methylation O a. You cannot methylate DNA O b. Enhances O c. Represses O d. Represses…

Q: In this example, we're going to see what happens when two traits are examined at the same time.…

A: Given information Fur and tail traits are observed at the same time. Dominant traits are black fur…

Q: In endochondral ossification, bone is formed from a template composed of: O epithelial membrane O…

A: Endochondral ossification is a embryonic process where bone starts formation by using hyaline…

Q: You see that a piece of DNA is being copied. But you cannot tell if this an example of DNA…

A: DNA replication is a process that makes multiple copies of particular DNA fragments so that they can…

Q: Mr. Kennedy is a regular coffee drinker. He feels more "alert" after a cup in the morning. This can…

A: The Placebo effect

Q: A male with blood type A and genotype Ii, mates with a female with blood type B and genotype IPi.…

A: The "ABO" blood group system is made up of four blood groups – A, B, AB, and O and is based mostly…

Q: Briefly describe a generalized plant embryogenesis.

A: Plants are eukaryotic, multicellular organisms belonging to the kingdom Plantae and are capable of…

Q: +1 1 4 6. 7 8 9. Transcriptional stop sequence +1 ТАTA box ATG ТАА AUG UAA Here is a diagram of a…

A: A base pair is two nucleotides that together constitute DNA ladder." A DNA nucleotide is composed of…

Q: Observe the structure shown below: 'N H. HCI H NH2 ОН О

A: Doxycycline is a broad-spectrum tetracycline-class antibiotic used in the treatment of infections…

Q: why we should be careful not to touch the throat swab to the lips, tongue, or uvula.

A: A throat swab is used to distinguish the presence of group A streptococcus microbes, the most…

Q: The digestive tract and the gut microbiome have a mutualistic relationship. What does this mean? O…

A: Mutualism is a type of symbiotic relationship where all species involved benefit from their…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: Three weeks ago, 20-year-old Sacheen came down with symptoms typical of the common cold. She had a…

A: Bronchitis disease and it's effect on patient.

Q: A group of snakes were all placed into environments that had differing selective pressures. Read the…

A: Natural selection of a particular trait can take place in 3 ways; they are Directional selection :…

Q: Which of the following does NOT pertain to the myoblast-determining gene 1?* a. It is a master gene.…

A: Developmental biology describes how interacting mechanisms generate an organism's various size,…

Q: 2. Label the muscles on the dorsal and ventral sides of the frog. Write all the answers in the next…

A: Frog contains many muscles on their dorsal and ventral sides. These muscles are needed to perform…

Q: Explain the amoeba process

A: The amoeba process is a method of cell division that results in the formation of two identical…

Q: Plants are highly dependent upon the resources of their enviroment. Explain how the lack of water…

A: In photosynthesis, two reaction has been shown light dependent reaction and light independent…

Q: Australopithecus afarensis differs from the later species of the genus Australopithecus (e.g.,…

A: Evolution of australopithecus afarensis.

Q: What is the function of a helper T cell? OA. to destroy cells that are already infected OB. to…

A: Helper t cells are helpful in adaptive immunity in our body. These cells recognise foreign antigens…

Q: Choose one of the small molecules. List what it's macro- molecule Structure is and describe how the…

A: Glucose molecules- is one of smallest molecules and it provides energy, from the structure of the…

Q: "BIKINI BOTTOM GENETICS" Use the information for SpongeBob's traits to write the phenotype (physical…

A: A trait is a characteristic features that is unique to particular individual . In the question ,…

Q: An action potential is shown below. Number 4 on the graph is showing which phase? 3 Membrane…

A: Action potential is a brief reversal of membrane potential where the membrane potential changes from…

Q: Label the following diagram: C D В A

A: Introduction Translation is a process by which protein is synthesized in our body. Ribosome is the…

Q: You are a Biology, what are the benefits of having an entrepreneurial mind set

A: Bio-business venture is an academy controlled business as it is driven by science based advancement.

Q: ODD ONE OUT: Choose the term that does NOT belong to the group then give the commonality among the…

A: Introduction Bryophytes is a proposed taxonomic division that includes the liverworts, hornworts,…

Q: A population of wolves in a national park is known to be 150 individuals. As wildlife ecologist, you…

A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…

Q: Discuss and make comparisson about the reproductive organs of birds and reptiles. How are their…

A: Reptilia and aves Reptilia is a taxonomic class that includes all the reptiles, examples of reptiles…

Q: To examine: Whether the statement, "If an oxidation occurs in a reaction, it must be accompanied by…

A: When an electron is removed in a chemical reaction, the state is known as oxidised, and when an…

Q: Please give me a discussion/explanation of (LEAD DISCOVERY) part in drug discovery and development.

A: Lead Discovery Leads are the compounds for which the chemical structure has been identified and…

Q: Q16. How many differentially expressed genes can you identify using only 1 sample in each group and…

A: Gene expression is the process by which information from a gene is used in the synthesis of a…

Q: Construct a restriction map for Plasmid X to show the recognition sites for two commonly used…

A: A restriction map is a representation of known restriction sites in a DNA sequence. Restriction…

Q: Can a person be born with hemophilia if his parents don't have the disorder? A) Yes, about one-third…

A: Hemophilia is a disorder in which blood clotting does not take place normally. It takes place by…

Q: Cise . that the two khotS In rigure аге гегated a sequence of mutations. Figure 2.34 Two nasty…

A: First note that T1T2T3, the closure of the composition of the tangles T1,T2T1,T2 and T3T3, is equal…

Q: Q6. Guinea pigs, which were homozygous for long, black hair were crossed with ones which were…

A: As per the guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…

Q: Give examples of species under Echinodermata that can be used as currency.

A: Sand dollar is a marine species belongs under the order Clypeastroida , class echinoidea and…

Q: Please give me a discussion/explanation of (INVITRO STUDIES AND INVIVO STUDIES) part in drug…

A: In vivo studies allow the long-term effects of the drug to be monitored and observed as well as…

Q: Let's Try (Evaluation) A. Direction: Read the statements carefully and identify whether the…

A: Neuron is the basic structural and functional unit of the nervous system. It conducts impulses from…

Q: This Z diagram of the light dependent reaction shows how an electron moves from the reaction center…

A: The "Zscheme" describes the oxidation/reduction changes that occur during photosynthesis's light…

Q: Among the relationships of volume, pressure and temperature of gas, which do you think explains why…

A: Introduction: Because the rib cage is not flexible and there is no musculature to move the ribs, the…

Q: write a short discussion

A: DNA measurement- DNA concentration measurement is a commonly performed procedure in life science and…

Q: Test Ill- Encircle the word that should not belong to the group. 41. mushroom, yeast, bacteria, mold…

A: Spider is an arachnid, arachnids have eight legs.

Q: Fetal hemoglobin has a higher affinity for oxygen than mother's hemoglobin due to inability of fetal…

A: Hemoglobin is a conjugated protein with four polypeptide chains. It facilitates the transport of…

Q: What structure is represented by 3 on the diagram? -5 Koopa -6 1 -4 3 |- PJ PG 9 7 7 7 7 7 7 7 7…

Q: 7. A 24-year-old schizophrenia patient with prominent cognitive symptoms and social impairment is…

A: Schizophrenia It is a condition when a person is unable to think, behave, speak, feel or respond…

Q: The drug Furosemide affects the body's water equilibrium by inhibiting the membrane proteins that…

A: There is a Presence of the Na¹+ - 2Cl¹- transpoter across the membrane of the ascending limb. This…

Q: Say something about HARDY-WEINBERG Principle pertaining to population genetics. If both allele and…

A: The Hardy-Weinberg principle states that a population's genotype, allele frequency, and absence of…

Q: Select the correct answer for each question. Explain why you chose that answer as opposed to the…

A: The vagus nerve is the tenth cranial nerve which is also the longest mixed cranial nerve. It carries…

Q: thus, clonal expansion is The HIV attack the O Helper T cell / inhibited O Regulatory T cells /…

A: Answer :- Option (A) is correct. - Helper T cell / inhibited.

Q: Describe atleast two CDk checkpoint in cell cycle and what is there role and what will happen if…

A: Introduction The cell cycle is made up of steps that help a cell divide. The G1, S, and G2 phases…

Question

A person has a blood pressure of 145/95. What does the number 145 represent?
Select one:
a. systolic pressure due to ventricles relaxing
O b. diastolic pressure due to ventricles relaxing
O c. systolic pressure due to ventricles contracting
O d. diastolic pressure due to ventricles contracting

What is one purpose for vasodilation of blood vessels in the skin?
Select one:
O a. to stimulate muscle contraction (shivering)
O b. to permit concurrent heat exchange
O c.
to cool the body on a hot day
O d.
to conserve heat on a cold day

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

1st Answer and Explanation

VIEW

2nd answer and explanation

VIEW

Conclusion

VIEW

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Why is blood pressure high just after waking up? a. due to normal body circadian rhythm b. body releases hormones in the morning such as adrenaline and noradrenaline which boosts of energy but raises blood pressure c. both a and b are correct d. none of these choices are correct
a. What changes in the Pulse Rate and Blood Pressure will you notice as a person exercises? Make a concept map regarding the explanation behind the changes in the PR and BP as a person exerted physical activity. b.What changes in the Pulse Rate and Blood Pressure will you notice before and after eating? What's the possible explanation behind such changes? c. What changes in the Pulse Rate and Blood Pressure will you notice from reclining to standing position? Explain the possible explanation as the subject changed his body position from reclining to sitting and then to a standing position.
How might the body maintain homeostasis if blood pressure rises toohigh?a. By boosting the volume of bloodb. By increasing the heart ratec. By dilating the blood vessels near the skind. By raising the diastolic pressure
An increase in blood PH will ? a. Increase hemoglobin saturation B. Decrease hemoglobin saturation C. Decrease heart rate D. Decrease respiratory rate
How do arteries differ from veins?a. Arteries have thicker wall layers to accommodate the changes in pressure from the heart.b. Arteries carry blood.c. Arteries have thinner wall layers and valves and move blood by the action of skeletal muscle.d. Arteries are thin walled and are used for gas exchange.
What is the primary purpose of applying heat therapy to a patient's inflamed joint? a) To reduce blood flow to the area b) To promote vasodilation and increase blood flow c) To numb the area and reduce pain perception d) To inhibit bacterial growth
Which of the following statements regarding blood pressure is NOT true? a.)Blood pressure is constant throughout the body b.)Exerted by the blood against the walls of the blood vessels c.)Controlled by homeostatic mechanism d.)Keeps the blood flowing through all the blood vessels so that cells receive oxygen and nutrients
Which of the following is a circulatory adjustment to sustained moderate exercise? A. Constriction of the cutaneous circulation B) Decreased intestinal blood flow C. Decreased venous return D. Increased renal blood flow E) Increased total peripheral vascular resistar
Which of the following happens in zero gravity due to the re-distribution of fluids in your body? a your lower legs become bloated and increase in circumference b your blood no longer clots properly when your skin gets cut c you frequently feel the need to urinate d your mouth becomes dry
What do the vessels that are carrying oxygen-poor blood back to the heart have that stops blood from flowing backwards? A.thick muscular walls B.valves C.hemoglobin D.SA nodes
The primary function of the pleural membranes is ____ A. to decrease friction and allow the lungs to move within the thoracic cavity is B. to decrease surface tension by producing surfactant C. to prevent the lungs from putting pressure on the heart and surrounding vessels D. to prevent respiratory infections
When oxygen-rich blood from the lungs is pumped to the rest of the body, so the cells can use the oxygen - oxygen - poor blood is then turned to the heart is ??? A. Circulation B. Heart circulation C. Pulmonary circulation D. Systematic circulation