Please help explain this figure NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-021-27097-8ARTICLEabpull-downS1RBDS2pull-downSpike-6P319541 6851208(kDa)(KDa)S1 HEFC-Human ACE2-- 150S1-FcHuman ACE2-150100-100150150Hamster Ace2;Hamster Ace2-FRBD+FcHRBD-Fc100100Control-FcefRBD-FcSpike-6P, S1-Fc, RBD-Fc,or Control i.p.100OControlORBD-Fc 37°CRBD-Fc 4°Cor Control i.p.S1-Fc-0.5 0 1224 (hours)FITC-FeSamplingdgControl-Fc0.0001 0.0188shamh250-200-s1-FcRBD-Fc0.0330(kDa)1500.03121.5-Ace2150-0.05631000.0024100-Gapdh -371.0-0.003550-Acid0.505:Control-FcS1-FcRBD-Fc(kDa)Ace2 :1500.0Acid:100: -RBD-Fc:Gapdh- 37S1-Fc:iSham, vehicle Acid, Spike-6P1.50.0004(kDa)150Ace2 ;1.0-100Gapdh-370.50.0seen in the mice infected with SARS coronavirus10. To test this, recombinant Spike proteins indeed bound to both human ACE2we prepared three constructs for recombinant proteins of SARS- and hamster Ace2 (Fig. 2b; Supplementary Fig. ld-g). SinceCoV-2 Spike; trimeric Spike (1-1208 amino acids) with 6 proline recombinant Spike or RBD of the SARS coronavirus down-substitutions retaining the prefusion conformation32, S1 domain regulates ACE2 expression10,33, we examined the effects of SARS-(1-685 amino acids) and receptor-binding domain (RBD) CoV-2 Spike protein on ACE2 expression. We treated Vero E6(319-541 amino acids) fused to human Fc, described hereafter as cells with RBD-Fc and analyzed expression of endogenous ACE2Spike-6P, S1-Fc, and RBD-Fc, respectively (Fig. 2a). We expressed on the cell surface. RBD-Fc bound to endogenous ACE2 in Veroand purified Spike-6P, S1-Fc, and RBD-Fc proteins in 293 cells E6 cells (Fig. 2c, d; Supplementary Fig. 1h). Decreased binding of(Supplementary Fig. 1c). In in vitro pull-down assays, all the RBD-Fc to ACE2 at 37 °C compared with at 4°C suggested thatNATURE COMMUNICATIONS | (2021)12:6791|https://doi.org/10.1038/s41467-021-27097-8 | www.nature.com/naturecommunicationsSpike-6P, S1-Fc, RBD-Fc,LysateControl-FcControlS1-FcRBD-FcRBD-Fc 40RBD-Fc 370LysateVehicleSpike-6PAce2 / GapdhSham, vehicleAce2/ GapdhAcid, Spike-6P

A vital component of the renin-angiotensin system, angiotensin-converting enzyme 2 (ACE2) acts as…

a Spike-6P C count RBD-Fc S1-Fc d 8 3 S MFI 250 200- 150- 100- 1 50- Ace2 Gapdh S1 RBD 319 -S1- 541 685 +RBD+FC+ DOD Control RBD-Fc 40 FITC-Fe Control RBD-Fe 37°C RBD-FC 4°C 0.0001 0.0188 +FC+ RBD-FC 370 1208 e ➡ -0.5 0 g -> Ace2 Gapdh Ace2 Gapdh Sham, vehicle Acid, Spike-6P b Human ACE2 Hamster Ace2- Acid i.t. -37 Spike-6P, S1-Fc, RBD-Fc, or Control i.p. 12 (kDa) 150 100 or Control i.p. Spike-6P, S1-Fc, RBD-Fc, 24 (hours) Sampling Acid Control-Fc S1-FC sham Control-Fc S1-Fc RBD-Fc Ace2 / Gapdh 1.0 0.5- pull-down 0.0 Control-Fc Lysate S1-Fc f 0.0004 RBD-Fc Sham, vehicle Acid, Spike-6P RBD-Fc (kDa) 150 100 150 100 Control-Fc S1-FC (kDa) 150 100 Human ACE2- Hamster Ace2- -37 (kDa) 150 100 -37 h Ace2 / Gapdh 1.0- 0.0- Acid: S1-Fc: RBD-FC: - 0.0563 0.0312 pull-down 0.0330 + Lysate RBD-FC Vehicle Spike-6P 0.0024 0.0035 (kDa) 150 100 150 100

a Spike-6P C count RBD-Fc S1-Fc d 8 3 S MFI 250 200- 150- 100- 1 50- Ace2 Gapdh S1 RBD 319 -S1- 541 685 +RBD+FC+ DOD Control RBD-Fc 40 FITC-Fe Control RBD-Fe 37°C RBD-FC 4°C 0.0001 0.0188 +FC+ RBD-FC 370 1208 e ➡ -0.5 0 g -> Ace2 Gapdh Ace2 Gapdh Sham, vehicle Acid, Spike-6P b Human ACE2 Hamster Ace2- Acid i.t. -37 Spike-6P, S1-Fc, RBD-Fc, or Control i.p. 12 (kDa) 150 100 or Control i.p. Spike-6P, S1-Fc, RBD-Fc, 24 (hours) Sampling Acid Control-Fc S1-FC sham Control-Fc S1-Fc RBD-Fc Ace2 / Gapdh 1.0 0.5- pull-down 0.0 Control-Fc Lysate S1-Fc f 0.0004 RBD-Fc Sham, vehicle Acid, Spike-6P RBD-Fc (kDa) 150 100 150 100 Control-Fc S1-FC (kDa) 150 100 Human ACE2- Hamster Ace2- -37 (kDa) 150 100 -37 h Ace2 / Gapdh 1.0- 0.0- Acid: S1-Fc: RBD-FC: - 0.0563 0.0312 pull-down 0.0330 + Lysate RBD-FC Vehicle Spike-6P 0.0024 0.0035 (kDa) 150 100 150 100

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 8SQ

See similar textbooks

Similar questions

SARS-CoV-2, the virus that causes COVID-19, enters cells by binding the cell surface protein ACE2. Which do you expect is true of mouse ACE2? Its sequence is similar to the sequence of human ACE2 Its sequence is identical to the sequence of human ACE2 Its sequence bears no similarity to that of human ACE2
Define the following terms:a. homologous polypeptideb. molecular diseasec. protein foldd. mosaic proteine. ligand
Give typing answer with explanation and conclusion The following gene codes for a liver enzyme. Changing the A/T base pair to which of the following would result in a missense mutation? 5’ GCCTAATATGCCCGTATGC(AGC)nCGAATAAAATAGTACGGTCGTCGC 3’ 3’ CGGATTATACGGGCATACG(TCG)nGCTTATTTT ATCATGCCAGCAGCG5’ A. C/G B. T/A C. G/C D. Any of the above E. 2 of the above F. None of the above
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
Please answer fast Give ans for each statement 1.A protein linked to a disease state is being studied by scientists. They discover that the disease protein has the same amino acid sequence as the protein in healthy people. State right or wrong: Does the following explanation provide a plausible biological explanation for the disease state? a.The RNA polymerase does not correctly read the codon code on the mRNA. b.The protein is not being regulated properly. c.The disease protein is incorrectly folded. d. The disease protein lacks a post-translational modification. e.The protein amounts differ because they are expressed differently.
9. In which cellular compartments does mucin-type O-glycan biosynthesis occur in mammalian cells? Select all that apply. a. ER b. Golgi c. Plasma Membrane d. Mitochondria e. Nucleus 10. Identify the five nucleotide sugars NOT FOUND in animal cells. UDP-Glc UDP-GlcNAc UDP-Man UDP-Gal CMP-Fuc UDP-IdoA UDP-Xyl GDP-GalNAc CMP-Sia GDP-GlcA 11. Name at least two factors that determine glycan diversity during their biosynthesis. Availability of nucleotide sugars Expression of glycosyltransferases Nucleotide sugar biosynthetic enzymes The types and abundance of glycosyltransferases Flux through the ER and Golgi
The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been associated with many types ofcancers. For this reason, researchers would like to develop drugs toinhibit oncogenic rasH. Based on your understanding of the Rasprotein, what types of drugs might you develop? In other words,what would be the structure of the drugs, and how would theyinhibit Ras protein? How would you test the efficacy of the drugs?What might be some side effects?
Which statement(s) describe the function of the protein encoded by KMT2D ? Transcription factor involved in the DNA damage response. A component of haemoglobin. A subunit of - secreatase. An enzyme invovled in nucleotide biosynthesis. An enzyme involved in the breakdown of glycosaminoglycans (GAGS). Involved in fat and muscle cell differentiation A cell surface protein involved in iron absorption.
List the type, location (ex. C-terminus), and key feature (stretch of certain type of amino acids) for the sorting signal sequences you predict be present on GFP construct that allows it to end up in the organelle specified. If none, please note: a. GFP as a soluble lysosomal resident b. GFP ends up in the chloroplast stroma c. GFP ends up in the nucleus d. GFP is localized to the plasma membrane, with 3 transmembrane domains, and its N-terminus in the cytosol
Match the following protein pair with whther they are orthologues, paralogues or neither. Human Trypsin and Horse Trypsin Human Trypsin and Horse Chymotrypsin Human Trypsin and Human Elastase B subtilis subtilisin and Horse Chymotrypsin A. Orthologues B. Paralogues C. Neither
The following quote is from a TiBS review article (Y. Shiloh,(2006) TiBS vol. 31 No7 Pages 402-410). Please explain what information would have been derived from genetics experiments and what information would have been based on biochemistry experiments. Explain how using both genetic and biochemistry has allowed us to greatly enhance our understanding of this field. ATM belongs to a conserved family of proteins termed the ‘PI3K-like protein kinases’( PIKKs), most of which possess a serine/threonine kinase activity and all of which, as their name indicates, contain a domain with motifs that are typical of the lipid kinase phosphatidylinositol3- kinase(PI3K) [39]. At present, the mammalian members of this family include five protein kinases: ATM, ataxia-telangiectasia- and Rad3-related (ATR), hSMG-1, mTOR (also known as FRAP) and the catalytic subunit of the DNA-dependent protein kinase (DNA-PK). Another member of the PIKK family is TRRAP, a protein component of histone…
A human gene called theCFTR gene (for cystic fibrosis transmembrane regulator) encodes aprotein that functions in the transport of chloride ions across the cellmembrane. Most people have two copies of a functional CFTR geneand do not have cystic fibrosis. However, a mutant version of the CFTRgene is found in some people. If a person has two mutant copies ofthe gene, he or she develops the disease known as cystic fibrosis. Arethe following descriptions of this disease related to genetics at themolecular, cellular, organism, or population level?A. People with cystic fibrosis have lung problems due to a buildupof thick mucus in their lungs.B. The mutant CFTR gene encodes a defective chloride transporter.C. A defect in the chloride transporter causes a salt imbalance inlung cells.D. Scientists have wondered why the mutant CFTR gene is relativelycommon. In fact, it is the most common mutant gene that causesa severe disease in persons of Northern European descent. Onepossible explanation why…