Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair

Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 10RQ: Control of gene expression in eukaryotic cells occurs at which level(s)? a. only the transcriptional...

See similar textbooks

Similar questions

A mutation in Ras that prevents Ras from hydrolyzing GTP. Would cause? Why? A. Increased proliferation B. Decreased proliferation
Which statement(s) describe the function of the protein encoded by KMT2D ? Transcription factor involved in the DNA damage response. A component of haemoglobin. A subunit of - secreatase. An enzyme invovled in nucleotide biosynthesis. An enzyme involved in the breakdown of glycosaminoglycans (GAGS). Involved in fat and muscle cell differentiation A cell surface protein involved in iron absorption.
Control of gene expression in eukaryotic cells occurs at which level(s)? a. only the transcriptional level b. epigenetic and transcriptional levels c. epigenetic, transcriptional, and translational levels d. epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels
Which describes a cellular role of RanGEF? maintain Ran in the GTP bound form in the nucleus interact with importin-alpha stimulate/facilitate the inactivity of RAN provide the energy for the entry of the importins into the nucleus
Ras proteins are activated when they a. bind GTP. b. release GTP. c. bind GDP. d. undergo acetylation.
propose three festurs of a model to connect the genetic mutation you oredicted with the activity of a signaling pathway involving the LDS2B gene product
Predict how the mutation in the seventh codon of normal hemoglobin changing it from ctc to act, would it affect the protein being synthesized?
Suppose that you have cancer cell line X was treated with drug Y toincrease the expression levels of protein Z which is a tumorsuppressor gene. (no need for this qustion)Explain How can you study protein Z in these cells? (needed)
Cancer cells removed from a patient's tumor have increased gene expression of several hundred genes (including many cancer-causing genes). Scientists determine that the histones from the cancer cells have an overall/average lower affinity for DNA than histones from normal control cells. Which drug is most likely to help treat this patient's cancer? a. An inhibitor for HMT (histone methyltransferases) b. An inhibitor for HDM (histone demethylases) c. An inhibitor for HDACs (histone deacetylases) d. An inhibitor for HATs (histone acetyltransferase)
Give typed explanation Use the diagram representing the typical steps in gene expression and protein formation to respond. All of the following help the cell regulate gene expression during Step 2 of protein formationexcepta)general factors that are required for the RNA polymerase to bind to the promoter.b)repressors binding to the operator preventing the RNA polymerase from progressing.c)specialty factors binding to the RNA polymerase, altering its specificity.d)tRNA that binds to the RNA polymerase in the presence of complementary mRNA.
A particular drug inhibits the protein kinase that is responsible for phosphorylating the CREB protein. How would this drug affect the following events? A. The ability of the CREB protein to bind to CREs B. The ability of extracellular hormones to enhance cAMP levels C. The ability of the CREB protein to stimulate transcription D. The ability of the CREB protein to dimerize
a.What would happen if IKKbeta did not phosphorylate IkappaB? b.Why is it so hard to make cytokine therapies? c.Why would you use the MyD88 independent pathway versus the MyD88 dependent pathway?