A type of diabetes mellitus is due to defects in insulin signaling.  True  False

Q: What are the components of cephalins? Glycerol Two fatty acids Phosphoric acid Serine All of the…

A: Lipids are a very important class of biological molecule. Lipids can be classified into 2…

Q: Question 3: A runner just finished a marathon. For the enzymes listed below, indicate whether the…

A: During the marathon, the runner required extra glucose in the blood for physical activity.…

Q: What are the symptoms of nicotinamide deficiency and why are they so similar to the symptoms of an…

A: Nicotinamide is one of the forms of a vitamin, Niacin (Vitamin B3) in which the carboxyl group of…

Q: An animal cell is capable of converting alanine into serine.  What is the shortest pathway using…

A: Amino acids are classically considered the building blocks for the synthesis of proteins. The unique…

Q: Using the information in the following graphs that show activity of phosphofructokinase (PFK) with…

A: Phosphofructokinase is belong to glucose kinase group of enzyme and phosphofructokinase can be…

Q: e. Write the equations involved in the neutralization process of antacids. (Gastrointestinal Agents)

A: Antacids are medicines that are used to treat acidity. Antacids cure acidity by reacting with acids…

Q: 2. Enzymes of the pyruvate dehydrogenase complex.

A: PDC is a multienzyme complex that catalyzes the conversion of pyruvate to acetyl-CoA via glycolysis.…

Q: 1) Gluconeogenesis refers to ________. A) the breakdown of glycogen B) the formation of glucose from…

A: Generally, glucose is the preferred source of energy in our body. But of we are not eating properly…

Q: A mixture of two proteins (both with molecular mass of 50 kDa) with an isoelectric points of 7.8 and…

A: Proteins are polymers of amino acids linked by peptide bond. Alpha carbon of amino acids contains…

Q: A(n) (hydrolysis, oxidation reduction, group transfer, isomerization, internal rearrangment)…

A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…

Q: Complete the following reaction: P680 + light →_______→ O P680*; P680 + H+ O P680*; P680* + e O…

A: The P680 reaction center is a part of photosystem II. Upon getting hit by photons, P680 gets…

Q: Purine synthesis begins with the synthesis of IMP. Beginning with IMP, write the step(s) involved in…

A: Purines provide the essential  components for DNA and RNA . They act as building blocks for the…

Q: Exam pe reaction That require energy Catabolic Allosteric site ADP+POATP Entropy increases 2nd law…

A: Enzymes are catalysts that speed up biochemical reaction. These are workable under particular…

Q: The pyruvate dehydrogenase (PDH) complex catalyzes the oxidative decarboxylation of pyruvate to…

A: Pyruvate dehydrogenase (PDH) complex oxidizes pyruvate to acetyl-CoA and carbon dioxide. It takes…

Q: There is also another follow up question can you help me with this too please In the second cross, a…

A: A rabbit's coat colour is determined by four alleles: agouti (C), chinchilla (Cch), Himalayan (ch),…

Q: Biological value of cerebrosides and gangliosides.

A: The glycosphingolipid family includes the cerebrosides, which are crucial parts of the membranes of…

Q: 1. Classification, structure and properties of higher fatty acids, their biological role.

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: Which of the following stabilize the hemoglobin quaternary structure of low-affinity to oxygen…

A: Haemoglobin is an important protein present in RBCs. It coprises of four subunits. Each subunit has…

Q: true or false:  Pyrimidine synthesis involves the use of a molecule of N10-formyl…

A: Pyrimidine is one of the bases required in the nucleotides formation.

Q: Draw the steps involved in the catabolism of thymine into malonyl-CoA. Include the names and…

A: Nucleic acids are composed of nucleotides, and nucleotides are composed of a pentose sugar,…

Q: Which of the following is a second messenger that ultimately causes inhibition of glycogen synthase?

A: Glycogen synthase - is a key enzyme of glycogenesis and also called as UDP- glucosyltransferase. GS…

Q: He is administered a drug that inhibits bacterial enzyme that catalyzes bacterial DNA synthesis. The…

A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…

Q: 4. Why does DNA use Thymine instead of Uracil?

A: DNA is the type of nucleic acid, double stranded poly-nucleotide chain which work as the genetic…

Q: Name the components of products used in treating diarrhea and give the functions of each.

A: The term "gastrointestinal agents" refers to a broad category of medications used to treat…

Q: Epinephrine has the following structure. Which of the following amino acids are used by the…

A: Phe, Val, and Leu are hydrophobic amino acids that do not participate in H bonds or electrostatic…

Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: . Mucic Acid Test for Galactose and Lactose

A: Galactose and lactose can be found using the highly specific mucic acid test, which is used to…

Q: Meselson-Stahl Experiment showed that DNA replication is semi-conservative. In the experiment, DNA…

A: During DNA replication, each polynucleotide strand serves as a template for the production of a…

Q: 1.How many chiral center does D-Eranose have？ 2. How many stereoisomer are possible for D-Eranose.

A: Conformation is the different positions a molecule can twist into. Configuration is the arrangement…

Q: In the presence of saturating amounts of oxaloacetate, the activity of citrate synthase from pig…

A: Citrate synthase is the first and regulatory step the enzyme of citric acid cycle (TCA). Citrate…

Q: Which of the following liver metabolic pathways are not normally active at the same time but are…

A: Cortisol : This is steroid hormone that increases blood glucose levels. it decreases glucose uptake…

Q: • What is the common name of this fatty acid? cerotic acid, lauric acid, lignoceric acid, linoleic…

A: Fatty acids (FA) are aliphatic chain with one terminal carboxylic acid. Based on the presence or…

Q: What is the molecular basis for the difference in the electrophorentic pattern between normal…

A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…

Q: Please calculate the number of ATP that can be generated from one molecule of the fatty acid shown…

A: Most of the body's fatty acids are oxidized by beta-oxidation. The oxidation of fatty acids on the…

Q: Once AMP and GMP are synthesized, they are then converted to ADP and GDP, then to ATP and GDP. What…

A: Adenosine & Guanosine are purine nitrogen bases. To these phosphate groups are attached. AMP…

Q: Describe how the results of carbon-14 labeling experiments demonstrated that the citrate cycle is a…

A: The citric acid cycle involves the oxidation of acetyl-CoA into carbon dioxide and water. It is the…

Q: In two of the first three steps of glycolysis: Group of answer choices Phosphorylation reactions…

A: Introduction All living organisms need energy to carry various activities. Once we take food, it…

Q: Which of the following can serve as a source of carbon for gluconeogenesis? O cholesterol O alanine…

A: Gluconeogenesis is the metabolic pathway that produces glucose from non carbohydrate precursors.…

Q: Which of the following statements concerning translation is NOT correct? O a. The first codon of…

A: Translation is the process of translating codons on mRNA into proteins. mRNA bind to ribosomes which…

Q: Which of the following is TRUE under the following conditions: the enzyme concentration is 2.5 nM,…

A: The rate of reaction can be determined by using Michaelis Menten equation. Michaelis Menten equation…

Q: What is the name of this cofactor related to niacin? 0

A: Enzymes are proteins that catalyse biochemical reaction. Sometimes enzymes require a non protein…

Q: hat roles do ionizable amino acids play in the active sites of enzymes

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: Do carbohydrates and sugars cause weight gain? Briefly Explain the answer.

A: Carbohydrates are biomolecules that act as the major source of energy. Sugars are carbohydrates with…

Q: Problem. The student conducted a chemical experiment to prove the reducing properties of maltose…

A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…

Q: LO43 Identify the levels at which gene expression can be regulated in prokaryotes and eukaryotes…

A: Gene regulation is the process of control of expression genes. This process occurs by several…

Q: A characteristic of complex III is that it is reduced by FADH2. participates in electron transfer…

A: ETC consist of four protein complexes called Complex I,  II, III and  IV that transport electron…

Q: In order to stabilize a protonated Asp amino acid in an active site, an enzyme could: Choose the one…

A: Enzymes are usually protein which consist of reactant/substrate binding site called as active site.…

Q: A patient of African American decent came in due to vasooclusive symptoms, you suspect a condition…

A: Hemoglobin is a tetrameric protein that transports oxygen to the tissues and CO2 to the lungs. Each…

Q: ----------------------the simplest lipids but they may be a part of or a source of many complex…

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: true or false: Glutamine PRPP amidotransferase is regulated via product inhibition.

A: Glutamine PRPP amidotransferase is an  enzyme that catalyses the reaction of conversion of Phospho…