Which of the following liver metabolic pathways are not normally active at the same time but are activated in response to cortisol? glycolysis and gluconeogenesis fatty acid oxidation and fatty acid synthesis O glycogen storage and gluconeogenesis O ketone body synthesis and fatty acid synthesis
Q: Maargerines made from plant oils are healthier, since they are hydrogenated for spreadability?…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: (a) An experiment can be designed to test the effect of different temperature levels on the…
A: The independent variable is the parameter which we expect to affect the dependent variable. The…
Q: 3.5 An a helical, intracellular protein, ITSME, denatures at 80 degrees Celsius. Which of the…
A: Proteins are polymers of amino acid residues linked together via a peptide bond. The amino acid…
Q: For the net production of a molecule of glucose from CO₂, ribulose-1,5-bisphosphate must react with…
A: Synthesis of glucose from phosphoglycerate occurs through the process gluconeogenesis. ribulose 1,5…
Q: Sample w/ water w/ pancreatin Observation Exploratory questions: 3. What type of hydrolysis is used…
A: Animal fat and vegetable oils are simple fats or triglycerides. Triglycerides are fatty acid esters…
Q: 4. Which of the following mutations would most likely keep the transitions of T state to R state in…
A: Amino acids are biomolecules that have a carboxyl group, an amino group and a side group linked to…
Q: What are the greatest structural features that differentiate sphingolipids from phosphoglycerides?
A: Lipids are a very important class of biological molecule. Lipids are a broader class of molecule…
Q: In an enzyme mechanism that generates a negative charge in the transition state, which of the…
A: When a substrate(S) binds to the active site of an enzyme(E), it leads to the formation of an ES…
Q: Once AMP and GMP are synthesized, they are then converted to ADP and GDP, then to ATP and GDP. What…
A: Adenosine & Guanosine are purine nitrogen bases. To these phosphate groups are attached. AMP…
Q: what is does the induced -fit model account for? 2 why are most enzyme inactive at higher…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Make a Concept Map about the Amino Acids. Separate them base on Essential, Non-Essential, and…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Write a description of the physical characteristics of the isolated starch and glycogen. Provide the…
A: Starch and Glycogen are Polysaccharides, made up of many units of monosacharides. Starch is reserve…
Q: 3. Why can DNA adopt both A- and B- forms, while RNA is restricted to the A-form?
A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…
Q: Which of the following substances derived from lipid catabolism serves as a precursor for glucose…
A: Triglycerides are fatty acid esters of glycerol. Three fatty acids are esterified to a single…
Q: What is the name of this cofactor related to niacin? 0 O-P :0 U -ро OH -CH₂ Н Н OH NH₂ OH Н OH 2+…
A: Niacin is also known as vitamin B3. It is also known as nicotinic acid. It is a water soluble…
Q: Consider the following pairs of fatty acids and underline the fatty acid in each pair that will have…
A: Fatty acids are very important class of macromolecules in our body. They are the simplest type of…
Q: Please help me calculate BSA and Net Abs (explaination and details pls)
A: Bovine Serum Albumin (BSA) is the most commonly used protein in research. It is obtained from the…
Q: 1. Acetyl-CoA labeled with ¹4C in both of its acetate carbon atoms is incubated with unlabeled…
A: The citric acid cycle, also called as the Tricarboxylic acid (TCA) cycle is the central metabolic…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: Which of the following is CORRECT?
A: In the reaction of Glycolysis, the △G values of the three irreversible reactions are : Glucose +…
Q: Given the data in the table below and your knowledge of the "chemical standard state" (X) and the…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: • What is the common name of this fatty acid? cerotic acid, lauric acid, lignoceric acid, linoleic…
A: Fatty acids (FA) are aliphatic chain with one terminal carboxylic acid. Based on the presence or…
Q: [Select] [Select] [Select] transport. V transport. would move across a membrane using simple…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: 5. Thin layer chromatography separates lipids in the following order: hydroxylated lipids, then…
A: The working principle of thin-layer chromatography is the same as column chromatography. A small…
Q: Biologically important steroids: (sterols – cholesterol and its derivatives, bile acids, steroid…
A: Steroids are derivatives of Cyclopentanoperhydrophenanthrene ring containing compounds. They have…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: The glycerol is a 3-carbon structure. (C―C―C) To each carbon atom there is attached one -OH group…
Q: n oil obtained from salmon is unusual in that all three fatty acid components are identical. The…
A: Introduction Lipid is one of the important biomolecule in our body. Lipid is present in the plasma…
Q: Q10.1: Answer the following three-part question. a) Calculate the ΔEº’ for the citrate cycle…
A: Converting malate to oxaloacetate: The regeneration of oxaloacetate in the citric acid cycle is…
Q: Imagine that you were asked to denature a protein; you know you can do so using urea. Your protein…
A: Denaturation is the process by which a protein looses it native structure, to the level that protein…
Q: If the following oligosaccharide was treated with an enzyme that cleaved only a1,4 glycosidic bonds,…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: true/false: Glutamine synthetase is responsible for the synthesis of glutamine from glutamate.
A: Both glutamate and glutamine are non-essential amino acids. These are glycogenic amino acids.…
Q: CH2OH 바 조 он г 어 H CH2OH ㅇ 애 1 에 Beta-Derunopyranose KH H+ H2M осH2он 애 애 애 alpha- D- erunopyrunose
A: Alpha and beta forms of monosaccharide sugars are called anomers. The two forms are isomers and…
Q: Classify the diluents use with respect to their osmotic pressure in relation to their contents of…
A: Cell membranes are semipermeable barriers, and osmotic gradients between intracellular and…
Q: 1. Compute the concentration of the standard solutions by completing Table B.1. Report your answers…
A: Bradford assay is a method to estimate the protein concentration in the given sample. It is based on…
Q: 1) Gluconeogenesis refers to ________. A) the breakdown of glycogen B) the formation of glucose from…
A: Generally, glucose is the preferred source of energy in our body. But of we are not eating properly…
Q: How much ATP would be generated by having one molecule of oxaloacetate being completely oxidized to…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate by…
Q: In active muscle cells, the pO2 is about 10 torr at the cell surface and 1 torr at the mitochondria…
A: Fractional saturation (Y) is the fraction of protein that is ligand bound. Y= moles of…
Q: . Effects of amino acid composition and sequence to protein folding
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: What is the isoelectric point of the following peptide molecule?…
A: The pH at which a specific molecule carries no net electrical charge is known as the isoelectric…
Q: Polypeptides are continuously synthesized and broken down within living systems. One of these…
A: A protein is a chain of amino acids which can be called a polypeptide. The polypeptide chain folds…
Q: In hepatocytes, the enzyme glucokinase catalyzes the ATP-coupled phosphorylation of glucose.…
A: Glucokinase is the enzyme that catalyses the phosphorylation of glucose in hepatocytes. It occurs…
Q: Provide 6 reactions that facilitate the synthesis of oxaloacetate
A: Introduction Oxaloacetic acid in the form of oxaloacetate is a metabolic intermediate in many…
Q: What is the name of this cofactor related to niacin? 0
A: Enzymes are proteins that catalyse biochemical reaction. Sometimes enzymes require a non protein…
Q: A(n) (hydrolysis, oxidation reduction, group transfer, isomerization, internal rearrangment)…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: Consider the two half-reactions below and their standard reduction potentials. NAD+ + H+ + 2e → NADH…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: The total degradation of a fatty acid with an odd number of carbons yields acetyl-CoA and another…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: At pH 10, what is the net charge of the peptide Asn-His-Glu-Cys-Ser-Lys?
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Label the parts of the below lipid molecule. Is this a saturated or unsaturated lipid? H H I-U-I H…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: What elements do lipids contain?
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: 3..° i We seem to be constantly chasing the latest great oil to use for cooking and currently…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q22
Step by step
Solved in 2 steps
- Which of the following is the primary process by which insulin stimulates glucose transport into adipose tissue cells?A) Activating Na+-K+ ATPaseB) Increasing synthesis of the glucose transporterC) Phosphorylating glucose to maintain the gradient of free glucose across the cellD) Promoting movement of the glucose transporter from the cytoplasm to the cell membranehormone-sensitive lipase that are needed for triacylglycerol mobilization is activated by: Epinephrine adipocytes cAMP triacyglycerolWhich of the following enzymes are activated after insulin binds to its receptor? (select all that apply) Protein Phosphatase-1 Glycogen Synthase Lipase Acetyl CoA Carboxylase Glycogen phosphorylase Glycogen phosphorylase kinase
- People with non-insulin-dependent diabetes mellitus are generally not ketosis prone. This is thought to be a result of: the lack of increase in glucagons in the se individuals the presence of insulin in the individuals their obesity the fact that, their blood glucose levels do not tend to rise significantly Metabolic actions of insulin include all of the following except: increased glycogenesis decreased gluconeogenesis increased basal metabolic rate increased skeletal muscle amino acid up-take all of the above are metabolic actions of insulinWhen blood sugar is ________ the islets of Langerhans release ________ in order to tell the cells of the body to start taking in and storing glucose. low; glucagon high; glucagon low; insulin high; insulinThe hormones insulin and glucagon are produced, respectively, by Group of answer choices Insulin Glucagon Alpha cells of the pancreas Liver cells Insulin Glucagon Alpha cells of the pancreas Beta cells of the pancreas Insulin Glucagon Beta cells of the pancreas Liver cells Insulin Glucagon Beta cells of the pancreas Alpha cells of the pancreas
- Choose the correct. Insulin inhibits this catabolic process:A. Conversion of protein to aminoacidsB. Conversion of aminoacids to proteinsC. Conversion of glucose to fatty acidsD. GlycogenesisE. Conversion of fatty acids to triglyceridesInsulin regulates glucose uptake and breakdownIn muscle induces glucose into myocytes and gluconeogenesis there as well . true or falseInsulin is responsible for which of the following functions? Stimulating the breakdown of fat and proteins into glucose Stimulates the breakdown of glycogen to glucose Increases sugar levels in bloodstream Transports glucose into cells
- Which of the following statements about the integration of fat and carbohydrate metabolism control is correct? a. High insulin/glucagon ratio activates lipolysis in muscle b. High insulin/glucagon ratio inhibits lipogenesis in liver. c. Low insulin/glucagon ratio activates lipolysis in adipocytes. d. Insulin-dependent glucose transporters are recruited to their functional membrane site when insulin levels are lowAccording to glycogen metabolism, which of the following statementsis/are not true? I. Insulin results in dephosphorylation and subsequentactivation ofglycogen synthase. II. cAMP is a second messenger that triggers an increase in glycogensynthesis. III. Release of epinephrine leads to increased glycogen breakdown. IV. Glucagon promotes glycogen breakdown. V. Glucose-6-phosphate is an allosteric inhibitor of.phosphorylase A) I and VB) III and VC) II onlyD) III and IVE) V onlyA patient has a defective liver FBPase-2 enzyme, the enzyme that converts F2,6P into F6P. This enzyme is inactive. What effect would this have on the differential regulation of glycolysis and gluconeogenesis in liver cells? How would this affect a person’s ability to respond appropriately to a low blood sugar state? What about a high blood sugar state?
