30. The following figure shows an electrophoretic analysis of the hemoglobin proteins present in normal adults, newborns, andfetuses. Each band represents a complete hemoglobin protein with all of its subunits. The intensity of the band indicates therelative amount of that protein in the sample.YAdultNewbornFetusa. What is the subunit structure of the hemoglobin molecules marked X, Y, and Z?b. Name one abnormal condition that should increase the percentage of HbZ hemoglobin in a newborn.c. Name one abnormal condition that should increase the percentage of HbY hemoglobin in an adult.

Electrophoresis of hemoglobin: Red cell lysates are exposed to electric fields in hemoglobin…

a. What is the subunit structure of the hemoglobin molecules marked X, Y, and Z? b. Name one abnormal condition that should increase the percentage of HbZ hemoglobin in a newborn. c. Name one abnormal condition that should increase the percentage of HbY hemoglobin in an adult.

a. What is the subunit structure of the hemoglobin molecules marked X, Y, and Z? b. Name one abnormal condition that should increase the percentage of HbZ hemoglobin in a newborn. c. Name one abnormal condition that should increase the percentage of HbY hemoglobin in an adult.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 1TYU: When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain...

See similar textbooks

Related questions

Q: Describe the structure of hemoglobin.

A: Hemoglobin (Hb) is an oilgomeric, conjugated, globular and water soluble protein with 4 polypeptide…

Q: Determine what type of anemia could cause a reduced hemoglobin level while the person still ahs…

A: Your body uses iron to make hemoglobin. A lack of iron in the body is the most common cause of…

Q: In easy to understand words, explain Dietary factors affecting Red Blood Cell Production

A: Production of red blood cells (erythrocytes) is regulated by erythropoietin. Erythropoietin is a…

Q: Answer Briefly 4.1 Why is hemolytic anemia common in premature infants?

A: Blood contains RBC which contain hemoglobin, a protein that transports oxygen though out the body…

Q: Describe the structure and function of hemoglobin.

A: Hemoglobin is a protein pigment found in red blood cells. It is a globular protein conjugated with…

Q: Which statement describes hemoglobin's cooperativity? A. When tetrameric hemoglobin binds one…

A: The hemoglobin cooperativity binding effect can be defined as it is the ability of hemoglobin…

Q: Progressive hemothorax does not include() A) Abnormal respiratory movement B) Progressive increase…

A: Some of the respiratory disorders are pneumonia, asthma, lung cancer, cystic fibrosis, tuberculosis…

Q: What is the difference in the quaternary structure between fetal hemoglobin and adult hemoglobin?…

A: Proteins are the ultimate products of the genes. DNA is transcribed into m RNA and this is…

Q: How is the blood in the pulmonary artery and pulmonary veins different from the blood in the other…

A: The pulmonary artery and pulmonary veins are the main pathways for the transportation of blood…

Q: a. Explain how obstruction develops with chronicbronchitis.b. Explain how acute asthma causes air…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: The metal present in the haemoglobin is _______.

A: Hemoglobin is an oxygen-carrying pigment and predominant protein in the red blood cells. The…

Q: Expand the term NHC?

A: In eukaryotes, apart from histone proteins, additional set of proteins are required for packing of…

Q: A general term that refers to an increased white blood cell count isa. leukopenia b. inflammation c.…

A: d)leukemia refers to an uncontrolled increase in the number of white blood cell.

Q: d. Why were the mother's and newborn's hemoglobin fractions so different? When will the hemoglobin…

A: HbA is a tetramer with two alpha chains and 2 beta chains.Hb F is a tetramer with two alpha chains…

Q: a. Which alphabet shows red blood cell? b. Human red blood cell does not have a nucleus. State two…

A: The diagram depicted above is the image of the respiratory system and the alveoli present in the…

Q: Define term fetal hemoglobin?

A: Blood is a fluid tissue that is made up of components like red blood cells, white blood cells, and…

Q: why it is important that fetal haemoglobin has higher oxygen affinity than adult haemoglobin

A: Blood is a fluid connective tissue that comprises red blood cells (RBC), white blood cells,…

Q: a. How does iron deficiency cause anemia? What are the characteristic features of red blood cells in…

A: The diseased condition in which the body lacks healthy red blood cells. Thus the blood is unable to…

Q: (a) Why is it important that the trachea is reinforced with cartilage rings? (b) Why is it…

A: Breathing is described as the movement of air between the atmosphere and the lung. It involves two…

Q: a. Why is a minimum flow rate of 5 Lpm recommended for oxygen delivery by mask? b. Why will an air…

A: Pulmonary ventilation refers to the movement of air into and out of the lungs. Diffusion is the…

Q: Discuss the survival response that occurs when blood loss exceeds 10%.

A: The general term for bleeding or blood cells is hemorrhage and is characterized by the escaping of…

Q: (a) Describe the process of erythropoiesis. (b) What name is given to the immature cell type…

A: Erythrocytes are the blood cells that have the hemoglobin pigment and function in the transport of…

Q: What is hemoglobin F?Why does the fetus need adifferent hemoglobin?

A: Hemoglobin is a protein responsible for carrying oxygen. This protein is found in the red blood…

Q: In a table, differentiate the three blood cells. Take note of their properties and functions, as…

A: Blood is the most important tissue of the body. Blood performs variety of different functions among…

Q: What is the role of the heme prosthetic group in hemoglobin? A. The heme group coordinates the…

A: Hemoglobin is an iron-containing molecule important for biological processes. One hemoglobin…

Q: Does a fetus homozygous for sickle-cell hemoglobin (Hb S) have normal Hb F?

A: Introduction: Sickle cell anemia(HbS) is caused due to a point mutation at the sixth position of the…

Q: Which test measures the amount of hemoglobin in a volume of blood?

A: The term hemoglobin is associated with a protein found in the red blood cells. This protein is…

Q: Explain how the following conditions affect the structure and function of hemoglobin. Sickle cell…

A: Hemoglobin is a transport protein. Hemoglobin has four subunits and each subunit contains…

Q: Describe the function, structure (primary to quarternary), and shape of hemoglobin.

A: Hemoglobin is the red blood pigment exclusively found in erythrocytes. It is a globular protein and…

Q: What does the term hematocrit mean? a) The number of white blood cells in the blood b) The number…

A: Blood is a type of connective tissue, liquid in its form which flows in the blood vessels of the…

Q: Explain the difference between a differential white blood cell count and a total white blood cell…

A: The white blood cells are also known as leukocytes are the cells that are a major component of the…

Q: Describe the structure of hemoglobin .

A: Hemoglobin is a tetrameric protein of erythrocytes. It consists of a pair of Alpha light chains ,…

Q: Describe three signs of CHF in infants.

A: Congestive heart failure (CHF) is a condition related to the blood-pumping organ. In this condition,…

Q: One hemoglobin molecule can carry up to four oxygen molecules? A. True B. False

A: Hemoglobin (abbreviated as Hgb or Hb) is a protein molecule found in red blood cells that transports…

Q: Which condition enhances the release of oxygen from hemoglobin ? A) High blood viscosity B) Low…

A: Option D is the answer. Low blood pH favours release of Oxygen from oxy-hemogobin.

Q: "form fits function" a explain what this phrase means b explain how lungs are an example of this…

A: A) This term is applied to all living creatures like animals.As we know that shape varies in all…

Q: Explain how the number of red blood cells in blood changes with increased altitude

A: The blood is the fluid connective tissue that functions in transport of gases, nutrients, hormones,…

Q: Expand the term HGP?

A: HGP was initiated in 1990 in a coordinated effort by the US department of energy and the national…

Q: Explain how hemoglobin is able to transport oxygen and carbon dioxide

A: The exchange of gases is performed by the respiratory system of the body. The oxygen and carbon…

Q: What is hemoglobin AC?

A: Hemoglobin is a globular hemeprotein, and tightly bound prosthetic group called heme. The main…

Q: Describe why veins and arteries are reversed in the pulmonary system

A: According to bartleby expert guidelines, when multiple questions are posted we are allowed to answer…

Q: Which is a difference between fetal and adult hemoglobin?

A: Answer - Correct option (D) Fetal hemoglobin has a greater affinity for oxygen than adult…

Q: HOW Different Hemoglobins Are Expressed atDifferent Developmental Stages?

A: Hemoglobin is a protein found in red blood cells concerned with the transport of oxygen. The…

Q: 1. a. If transpulmonary pressure equals zero, what will happen to the lungs? b. This is known as…

A: Question - 1. a. If transpulmonary pressure equals zero, what will happen to the lungs? b. This is…

Q: In easy to understand words, explain Dietary factors affecting Red Blood Cell destruction

A: Haemolysis is the destruction of red blood cells. Haemolysis is the condition in which red blood…

Q: How does the oxygen-binding curve of fetal hemoglobin differ from that of adult hemoglobin?

A: In humans, the primary oxygen carrier protein for the fetus is known as fetal hemoglobin. Hemoglobin…

Q: Explain why individuals with pernicious anemia have a lowhemoglobin level.

A: Anemia: A disease condition that arises because of a deficiency of healthy red blood cells. This…

Concept explainers

Nitrogen metabolism

Nitrogen metabolism is the synthesis, utilization or uptake, breakdown, and excretion of nitrogenous compounds in the body. The nitrogen metabolism encompasses nitrogen fixation, biosynthesis, and the breakdown of amino acids, purines, and pyrimidine. Since nitrogen-containing compounds are required for various life processes, nitrogen is an important element of life.

Question

30. The following figure shows an electrophoretic analysis of the hemoglobin proteins present in normal adults, newborns, and
fetuses. Each band represents a complete hemoglobin protein with all of its subunits. The intensity of the band indicates the
relative amount of that protein in the sample.
Y
Adult
Newborn
Fetus
a. What is the subunit structure of the hemoglobin molecules marked X, Y, and Z?
b. Name one abnormal condition that should increase the percentage of HbZ hemoglobin in a newborn.
c. Name one abnormal condition that should increase the percentage of HbY hemoglobin in an adult.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle cell hemoglobin:Normal: GGG CTT CTT TTTSickle: GGG CAT CTT TTTa. Transcribe and translate the normal and sickle cell DNA. b. Identify this as a point or frameshift mutation. Explain. c. If the base sequence read GGG CTT CTT AAA instead, would this result in sickle cell hemoglobin? Explain.
1. How many TSS sites were identified using this technique? 2. Look at the labels next to each of the annotated TSSs. What are the labels for the TSS sites? 3. What is the coordinate for TSS_tra_16584216?
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… d) Assuming the sequence above is a bacterial gene, identify the region encoding the Shine-Dalgarno sequence. e) What is the function of the shine Dalgarno sequence?
Hello! Can you please explain why C is correct?
10 one is incorrect?
14. a)What is the complementary strand of TTGACAGTAAAA? b)List the possible genotypes for an individual with type A blood. c)How many chromosomes are in human beings?
1. Search for the `P06858` a) Give information about the PTM and Processing of this protein. b) Which position has maximum amount of variations? Give details about the variations. (Eg: What kind of variation? Feature ID? Disease association? etc..)
1. A mixture of proteins with the following properties were purified using cation exchange chromatography. Which of the following peaks correspond to the correct protein?Protein M- pI- 11, size- 60 KdaProtein N- pI- 8, size- 112 KdaProtein O- pI- 6, size- 280 KdaProtein P- pI- 4, size- 36 Kda[N.B: I was trying to upload pictures, but it was interrupting, Peak C is the highest peak, Peak D is lowest, Peak B is higher than D; however lower than C and A, Peak A is lower than C only, higher than B and D] a) Peak A is P b) Peak C in N c) Peak D is P d) Peak B is O e) Peak A is M 2. Which transition state analog is the most effective competitor for serine protease such as Chymotrypsin?a) R-C=O-NH-R’b) R-C=O(CH3)-NH-R’c) R-CH(OH)-CH(NH2)-R’d) R-CH(OH)-NH-R’e) R-CH=NR’ 3. If a 14C fatty acid labelled with C14 is fed to a cow, after 30 minutes of Beta oxidation, where will the C14 be found?a) Acetyl coA b) Propionyl coA c) Glutamine d) Glucose 4. How many carbons will…
Sickle cell anemia is caused by a point mutation in the β-globin chain of hemoglobin. Glutamic acid is replaced by Valine. HBB sequence in normal adult hemoglobin (Hb A): Leu-Thr-Pro-Glu-Glu-Lys-Ser HBB sequence in mutant adult hemoglobin (Hb S): Leu-Thr-Pro-Val-Glu-Lys-Ser What effect does this mutation have on the structure and function of the protein? Predict what would happen to the RBC if the glutamic acid was replaced with asparagine instead of valine.
Below is the DNA base sequence for the normal protein for normal hemoglobin and the base sequence for (abnormal) sickle cell hemoglobin: Normal GGG CTT CTT TTT Sickle GGG CAT CTT TTT A)Transcribe and translate the normal and sickle cell DNA. B)Identify this as a point or frameshift mutation. Explain.
4. How do sialic acid conformations explain the difference between influenza strains that infect humans and those that infect chickens?
In the Western blot shown here, proteins were isolated from redblood cells and muscle cells from two different individuals. Oneindividual was unaffected, and the other suffered from a diseaseknown as thalassemia, which involves a defect in hemoglobin. Theblot was exposed to an antibody that recognizes β globin, whichis one of the polypeptides that constitute hemoglobin. Equal totalamounts of cellular proteins were added to each lane. Explain these results.