add 9.9mL of sterile medium to give you a Dilution Tube #2. What is the concentration of bacterial cells in Dilution Tube #1 and Dilution Tube #2? ( ts). Here is a hypothetical gene showing the sequence of DNA nucleotides for the template strand (note: the template strand is the strand that is transcribed). This sequence includes the regions that code for start and stop codons in translation as well as introns and exons. The Introns are indicated by UNDERLINED NUCLEOTIDES. ding Strand of DNA: (-25) ..TATAAA....... TACTCGATAGCCGAATGTCTTC CTCAGAC A... 5' +1 Describe the role of the following in transcription of this DNA strand: a. RNA Polymerase b. Promoters c. Transcription factors d. Initiation, elongation and Termination of the pre-mRNA strand ranscribe the above DNA into a pre-mRNA Molecule ou have just transcribed the above molecule of messenger RNA in the nucleus of a uman cell. What types of modifications will occur to this RNA before it leaves the acleus? raw what the finished mRNA product will look like as it exits the nucleus. ino Acid sequence

add 9.9mL of sterile medium to give you a Dilution Tube #2. What is the concentration of bacterial cells in Dilution Tube #1 and Dilution Tube #2? ( ts). Here is a hypothetical gene showing the sequence of DNA nucleotides for the template strand (note: the template strand is the strand that is transcribed). This sequence includes the regions that code for start and stop codons in translation as well as introns and exons. The Introns are indicated by UNDERLINED NUCLEOTIDES. ding Strand of DNA: (-25) ..TATAAA....... TACTCGATAGCCGAATGTCTTC CTCAGAC A... 5' +1 Describe the role of the following in transcription of this DNA strand: a. RNA Polymerase b. Promoters c. Transcription factors d. Initiation, elongation and Termination of the pre-mRNA strand ranscribe the above DNA into a pre-mRNA Molecule ou have just transcribed the above molecule of messenger RNA in the nucleus of a uman cell. What types of modifications will occur to this RNA before it leaves the acleus? raw what the finished mRNA product will look like as it exits the nucleus. ino Acid sequence

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 4DAA: HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952...

See similar textbooks

Similar questions

One hundred microliters (0.100 ml) of a 10-5 dilution of a bacterial suspension plated on an agar plate gave rise to 229 distinct colonies. What was the concentration of bacteria in the original, undiluted suspension?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. How did the researchers know that the radioisotopes in the fluid came from outside of the bacterial cells and not from bacteria that had been broken apart by whirling in the blender?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. The extracellular concentration of which isotope increased the most with blending?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Before blending what percentage of each isotope. 35S and 32P, was extracellular (outside the bacteria)?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Do these results imply that viruses inject DNA or protein into bacteria? Why or why not?
1. There are many ways you can accomplish a 1000-fold dilution. Propose 3 different serial dilution methods that will accomplish a dilution with a 1:1000 dilution factor. 2. Suppose you count 35 bacterial cells from a solution that has gone through the following serial dilutions: two 10-fold dilutions, followed by a 5-fold dilution, followed by 2-fold dilution. What should be the bacterial count from the original solution? Show your work! 3. When making a dilution you need to put different volumes of the stock solution and the buffer. Suppose you are doing a 2-fold dilution, where both volumes are the same. Will you use the same pipette tip to extract the stock and the buffer solution? Explain your reasoning.
If E. coli was allowed to grow for 80 minutes then what would be theproportions of light and hybrid densities DNA molecule?
given a phage lysate with 10^11 pfu/ml and a bacterial culture with 10^8 cfu/ml, how would you obtain MOI =0.1 ?
How would you dilute a stock solution of bacteria with an OD600 of 2.5 down to a solution that has an OD600 of 0.25?
You measure your E. coli and find them to have an OD600 of 1.20. You have 50 ml of culture, and you know that there are 2.5x109 cells per 1.0 OD600. Based on this information, how many E. coli cells are present in the culture you’re about to centrifuge?
What would the final concentration of a bacteria culture be if 2.7 x 106 cells/ml were diluted 8.2 x 10-2? What would the initial concentration of a bacteria culture be if the final concentration was 3.7 x 102 cells/ml and the total dilution was 4.6 x 10-4?