AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG AGGCGGGTAGGCACCCTTA TCCGCCCATCCGTGGGAAT

Q: The nucleotide composition of five DNA segments were determined. Which of these DNA segments is…

A: The correct answer is option 2 The segment with 24%C content.

Q: Which of the following sequences on a DNA moleculewould be complementary to GCTTATAT?a. TAGGCGCGb.…

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. It contains all genetic information that…

Q: If thymine makes up 15% of the nitrogenous bases in a specific DNA molecule, what percent of the…

A:

Q: Which of the following statements about DNA is true?

A: Answer is option a.)The two strands are held together by hydrogen bonds.

Q: Which of the following sequences would be complementary to a DNA strand with the sequence…

A: Complementarity refers to a relationship between two structures each following lock and key…

Q: If one strand of DNA has a sequence of TCAG, then the sequence of bases on the complementary strand…

A: DNA is double stranded where the two strands are antiparallel and follows complementary base…

Q: Which of the following characteristics does not describe DNA? a contains thymine b contains uracil…

A: DNA contain :  Adenine, thymine, cytosine and guanine.  DNA present in the nucleus.  Nucleus has…

Q: Which of the following is considered a "palindrome" in DNA? O GGATCC O AATTAA O CGATAGC

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: DNA strands are complementary to each other. If one strand has the nucleotide sequence ATTGGCCTT,…

A: DNA is composed of a backbone consisting of ribose sugar & phosphate, and nitrogen bases.…

Q: If one DNA strand is 5′–GGCATTACACTAGGCCT–3′, what is the sequence of the complementary strand?

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: A melting profile in figure below shows the increase in UV absorption versus temperature for two DNA…

A: The DNA is a double-stranded material where two single strands of DNA run antiparallel to make a…

Q: If a DNA strand has the sequence ATGCGATCCGC thenthe sequence on the complementary DNA strand is…

A: Answer is b.) TACGCTAGGCG.

Q: If a strand of DNA has the sequence CGGTATATC, then the complementary strand of DNA has the sequence…

A: Every living organism has Deoxyribonucleic acid (DNA). DNA has a recipe for synthesizing proteins.…

Q: If one DNA strand is 5′–GATTCGTTC–3′, what is the complementary strand?

A: Complementarity in the strands of DNA is referred to as a lock-and-key relationship between both the…

Q: If the sequence of one chain of a DNA double helix is TAACGTA, the sequence of its partner strand in…

A: Chargaff's rule express that DNA from any species of any life form ought to have a 1:1 protein…

Q: Which of the following is correct about the differences between DNA and RNA? DNA is usually…

A: INTRODUCTION DNA : Deoxyribonucleic acid RNA : Ribonucleic acid

Q: ider the structure and function of DNA. Which of the following statements is TRUE? O Because DNA…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: I am in Microbiology and the question is how would I turn the following DNA strands to primary…

A: The primary protein structure consists of the sequence of amino acids. It is the first level of the…

Q: The sequence of a DNA molecule also influences its melting temperature. Guanine-cytosine base pairs…

A: A molecule of DNA is a polymer of nucleotide. Each nucleotide consists of Deoxyribose sugar which is…

Q: What characteristic of DNA results in the requirement that some DNA synthesis be discontinuous?

A: Two strands of DNA run in the antiparallel direction. During replication, the replication fork is…

Q: One half of a DNA strand has the following sequence of bases GCTACGGCGTTATCCCC. What would appear on…

A: In a DNA molecule each deoxyribonucleotide is made up of a sugar, nitrogenous base and phosphoric…

Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…

A: Replication is the process of the formation of identical copies of DNA. It takes place in the…

Q: If this sequence of bases was on one side of a DNA moléčulé, whát wõuld be on the opposite side?…

A: The answer is TTTAGCC. The last option.

Q: The final steps of DNA synthesis involve the removal and replacement of primers with DNA, and the…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: The sequences of four DNA molecules are given bel ii. TTTCCCGGGAAA AAAGGGCCCTTT iv. GCCGGATCCGGC…

A: DNA molecules are the nucleic acids that contain sugar, phosphate and nitrogenous base. Sugar is…

Q: Which type of information about the nucleotide sequenceof the target DNA is required ?

A: Targeted sequencing is defined as a process in which there is a rapid as well as…

Q: If a DNA strand has the nucleotide sequence of CCGAGATTG, what is the nucleotide sequence of the…

A:

Q: Which of the following statements is true about DNA? Select one: O a. The two strands of DNA are…

A: The DNA molecule is a polymer of nucleotides.  Each nucleotide is composed of a nitrogenous base, a…

Q: Which of the following is found in a molecule of DNA? ribose phosphate groups deoxyribose…

A: DNA is the  genetic material of almost all the organisms, except few viruses and is present in the…

Q: The two strands of a DNA double helix can be separated by heating. If you raise the temperature of a…

A: A double-stranded DNA is joined together by a bond and seems to be a twisted ladder. Which is…

Q: When a DNA molecule is heated to an extreme temperature in a test tube, the two chains break apart.…

A: DNA is a double helical structure that forms the genetic material in all living cells. DNA is…

Q: Each DNA strand has a backbone that consists of alternating (a) purines and pyrimidines (b)…

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Q: Given the following DNA strand, which of the following is its complementary MRNA? G GACIGATT"…

A: Transcription and translation are two processes of gene expression. The process of the formation of…

Q: DNA does not participate directly in the synthesis of proteins. What molecule transfers the…

A: RNA molecules transfer the information from DNA to the site of protein synthesis during replication…

Q: Which of the following is true about DNA ? * O Two DNA strands are twisted around each other to form…

A: DNA is the hereditary material in humans and most of the other organism. It is made up of Nitrogen…

Q: Why Discontinuous synthesis of DNA requires enzymes ?

A: Continuous synthesis Discontinuous synthesis 1. DNA is synthesized from 5′ —>3′ in the…

Q: Which of the following does not code for an enzyme having both helicase and nuclease activity?a)…

A: Genetic recombination is the exchange of genetic material between different organisms which leads to…

Q: ich of the following pieces of DNA is going to be easier to separate into single stranded molecules…

A: A nucleotide is 2 chemical bases bonded to 1 another forming a "rung of the deoxyribonucleic acid…

Q: One strand of DNA reads:  GACTTCAGATC What would the complementary strand be?

A: The complementary strand of DNA can be identified easily. It is explained in step 2.

Q: Why does DNA have to turn into RNA before it can make a protein? why cant DNA just make the proteins…

A: Nucleic acids carry the genetic information of our body. The genetic information is like an…

Q: Which of the following relations or ratios would be true for a doublestranded DNA molecule? a. A + T…

A: DNA (Deoxyribonucleic acid) is the genetic material for all organisms except certain viruses. DNA…

Q: Match the correct bases pairs to find the opposite strand of DNA strand of       DNA -  T  G  C…

A: DNA is deoxyribonucleic acid. It is the genetic material which is double stranded, which means it…

Q: Which of the following DNA sequences would have the highest melting temperature? CGGAGCTCC…

A: Deoxy ribonucleic acid (DNA) is the genetic material for most organisms that carry coded genetic…

Q: Which of the following relations or ratios would be true for a double￾stranded DNA molecule? a. A +…

A: Deoxyribonucleic acid or DNA is a double-stranded molecule present in the nucleus of the cells in…

Q: The two strands of a DNA double helix can be separated by heating. if you raised the temperature of…

A: In the DNA strands, between every A-T base-pairing there are two hydrogen bonds present while In…

Q: Fill in the blank with the most appropriate term that is described by the following statement:…

A: The components of DNA replication. A five-membered, oxygen-containing ribose sugar ring with three…

Q: Which of the following could be the components of a single nucleotidefound in DNA?a. Deoxyribose,…

A: DNA STRUCTURE:- DNA structure is given by Watson and Crick, who proposed the double-helical…

Q: The DNA double helix holds together because the base pairs on each strand are attracted to each…

A: Cells are composed of macromolecules that have monomere units and are vital for structural and…

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.