Albinism is an autosomal recessive condition where little or no melanin pigment is produced. A woman (call her W) had an affected brother (B). This woman's daughter (M) is planning to have a child. The intended father (F) in this mating had a sister (S) who has albinism. a. Draw the pedigree of the family. Use defined symbols to indicate genotypes. Determine the probability that the female planning to have a child (M) is heterozygous. Determine the probability that her male partner (F) is heterozygous. Determine the overall probability that this couple (M and F) will have an unaffected child.

Q: Explain why the nucleotide sequence of the same gene that you inherited from your mother and father…

A: we inherit two copies of each chromosome—one copy from your mom and one copy from your dad. This…

Q: Which test measures percentage of hemoglobin within each red blood cell?

A: Haemoglobin, Hb is the iron-containing oxygen-transport metalloprotein in red blood cells. It is…

Q: List a few examples of cellular work. e. Where does the energy to make ATP come from? It doesn't…

A: 4 a. Exothermic,catabolic,G <0 The sign of ΔG for a reaction that is exothermic (ΔH is -ve) and…

Q: A heterozygous free-lobed man is mated to a heterozygous free-lobed woman. What are the genotypes…

A: Genotype is the genetic makeup of an organism.  It consists of 2 alleles in an individual.

Q: During phase I, venous return occurs and blood enters relaxed atria. The pressure in the veins is…

A: Aorta carries oxygenated blood to different parts of body and pulmonary arteries carry deoxygenated…

Q: What is the importance of plasma proteins?

A: Introduction In this question we will discuss about the importance of plasma proteins.

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

A:

Q: Give the different classes of each phylum. 1. Phylum Cnidaria 2. Phylum Mollusca 3. Phylum…

A: Cnidaria  Radial symmetry, tissue level of organisation, acoelomate animals. Classification: On the…

Q: As a genetic counselor, you inform Susan and John that a blood test for cystic fibrosis is…

A: Genetic counselor

Q: By looking at a plant externally can you tell whether a plant is C3 or C4? Why and how?

A: Introduction We will answer this question in below step.

Q: 26. In sheep, eye color is controlled by a single gene with two alleles. When a homozygous…

A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to…

Q: What would allow two cells from the same individual to respond differently to an environmental…

A: Cell communication It refers to the way a cell receives, understands, and sends signals to its…

Q: Fruit What is the type of fruit? What is the arrangement of the placenta? Yardlong Bean     Ulam…

A: Placenta, plural Placentas, orPlacentae, in botany, the surface of the carpel (extraordinarily…

Q: Please help with this question. It is not the third option with the three peaks.

A: Neurons are capable of replying to stimuli (such as touch, sound, mild, and so on), conducting…

Q: Hello sir, can you summarize, I mean, a short solution, not

A: BRAIN Neural prostheses can replace a motor, sensory or cognitive modality that got damaged due to…

Q: 12. The spindle checkpoint ensures that all chromosomes are attached to the mitotic spindle. If this…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Free Response: Fruit Flies Genetics To do well on the question, you will need to use the proper…

A: In fruit flies, the phenotype for eye color is determined by a certain locus. E indicates the…

Q: p + q = 1             p2 + 2pq + q2 = 1                    p is the frequency of the dominant…

A: The Hardy-Weinberg equilibrium states that the frequencies of alleles and genotypes in a population…

Q: Which meristem, mainly found in the shoot and roots tips, is responsible for primary growth? Read…

A: apical meristem, region of cells capable of division and growth in the root and shoot tips in…

Q: What is midpoint potential of redox active centers in photosynthetic organisms? What factors affect…

A: Note- as we are allowed to do only one question at a time. I'm posting answer of first question.…

Q: What basal trasncription factors can only bind to the dna within the pre-replication complex after…

A: Basal transcription factors are also known as general transcription factors. These bind to the…

Q: Problem 7: Consider three neuron nodes: S1, S2, and S3 with thresholds T1, T2, and T3 given as…

A: A potential energy surface (PES) describes the potential energy of a system, especially a collection…

Q: Which major organ lies deep to the right hypochondriac region? A. The stomach B. The spleen C. The…

A: An organ is a collection of tissues that structurally form a functional unit specialized to perform…

Q: 5. The oat coleoptiles on the left have been modified: either cut or placed in a light-blocking…

A: Introduction Phototropism refers to a plant's ability to re-orient its shoot growth towards a light…

Q: How many copies of a protein need to be present in a cell in order for it to be visible as a band on…

A: * Given that you can load 100 µg of cell extract onto a gel and can detect 10 ng in a single band by…

Q: If living cells were produced in a test tube from nonbiological components by chemical processes,…

A: The first cells that appeared on the earth are believed to be prokaryotic heterotrophic and are…

Q: 1.Describe the cytoskeleton function in cell movement. 2.What is the Endomembrane System?

A: Introduction The cytoskeleton is a network of different protein fibers, it is made up of…

Q: Which test measures platelet size?

A: Platelets, also known as thrombocytes, are small blood cells that aid in the clotting of blood. The…

Q: 4 4 -20 -15 -10 -5 0 Annual average temp T1. .1. of

A: Bergman's rule relates body size to the animal distribution according to the temperature. According…

Q: Which is considered as the plant's first line of defense against physical damage?Read and analyze…

A: A plant's first line of defense against infection is the physical barrier that is in the epidermis…

Q: Complete the table with the correct concepts you have learned about the different characteristics of…

A: The complete table is given in the next step.

Q: How can drug resistance in microorganisms be circumvented?

A: Antibiotic resistance is becoming a threat to the world now a days.  This is because, if microbes…

Q: Research and describe Georgy Gause’s P. caudatum and P. aurelia experiment.

A: INTRODUCTION In ecology, the competitive exclusion principle, often known as Gause's law, states…

Q: Your next-door neighbor has donated $100 in support of cancer research and is horrified to learn…

A: Yeasts are eukaryotic, single-celled microorganisms delegated individuals from the parasite kingdom.…

Q: What are the immunological implications of 'bare lymphocyte syndrome' /MHC deficiency?

A: Cell immunity

Q: An organism's life history traits influence its... O Diet O Reproduction O Survival O Reproduction…

A: The pattern of survival as well as reproduction events that take place during the life of an…

Q: Explain the following statements in 4-6 lines Humans are living longer, and that increases the risk…

A: Humans live a longer life than many other species. Humans have an average age of about 70 years.…

Q: We have seen that animals often encounter problems in dealingwith waste nitrogen. Considering…

A: The enzymes deaminase and transaminases catalyze the reactions including the transfer of nitrogen.

Q: Which test measures the average size of red blood cells?

A: Red blood cells(RBCs) or erythrocytes are blood cells containing a protein called haemoglobin which…

Q: What type of mutation is depicted by the following sequences (shown as mRNA)?Wild type ....5′…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: Of what significance is the difference in color of the dorsal and ventral surfaces of the body? What…

A: A coloration is a diagnostic tool for figuring out mammals, however, inquiry into its characteristic…

Q: After his workout, Devan drinks a protein shake that is high in both protein and sugar and low in…

A: An individual needs food after a workout to refuel, build muscle, and speed up the metabolism.…

Q: What are 3 phenotypes of GA, or BR, or ABA, or CK over-producing mutants

A: Note: Since you have posted multiple questions so we will be solving the first question for you. As…

Q: Which of the following dephosphorylates PI 3,4,5-trisphosphate, thereby blocking the activation of…

A: The survival and growth is promoted by the PI3K-Akt signaling pathway. Protein Kinase B and…

Q: In Central America, it has been found that if natural forests are retained within and around coffee…

A: Win-Win situation It is a kind of situation when all parties are benefitted or are satisfied in some…

Q: State the volume of air remaining in the lungs after a normal breathing.

A: Introduction In this question we have to state the volume of air remaining in the lungs after a…

Q: Underline the error in each of the following statements and provide the correction. Spike potential…

A: Action potential:  An action potential (AP) occurs in physiology when the membrane potential of a…

Q: Discuss "The respiratory pathway is an amphibolic pathway."

A: Introduction In this question we will discuss about " the respiratory pathway is an an amphibolic…

Q: What is meant by 'B lymphocytes are sensitive to clonal deletion'?

A: Immunity

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.