Q: TRUE OR FALSE 1. The antheridium of a moss could be seen as a whole mount at 100x magnification. 2...
A: Question 1 true The size of moss is about 1 to 2cm and the antheridium is about 2mm 100x power ca...
Q: What impact does the time of day, days of the month, or place where the tasks are completed have on ...
A: Clinical psychology is a branch of psychology that provides people and families with ongoing and com...
Q: body
A: Skin colour is largely determined by a pigment called melanin but other things are involved. Your sk...
Q: QUESTION 43 Which of the following statements is true about linkage disequilibrium? O a. D= -0.21 in...
A: Disequilibrium refers to imbalance, or spatial disorientation.
Q: Ecology and thermodynamics
A: Ecology is the discipline of science that studies living species, their environments, and their inte...
Q: how the regulation of DNA expression by the proteins that are bound to it and their inheritance infl...
A:
Q: choose correct option nd do explain shortly plz.
A: The origin of life on earth is backed by numerous theories such as theory of special creation, abiog...
Q: . What are the advantages and disadvantages of using the Hanging drop technique?
A: Introduction :- The hanging drop technique can be used to examine living microorganisms. This entail...
Q: Identify and explain what insects are expected to have the most sclerotized heads? Does an exoskelet...
A: Scelerotin is typically a brown coloured substance found in cuticles of insects. Scelerotin is forme...
Q: Antibiotics should be reduced or eliminated from culture media during cell subculturing. Make it mor...
A: Subculturing, also known as passaging cells, is the process of removing the media from an old cultur...
Q: distinguish between bacterial cells that obtained the plasmid and those that did not
A: Bacteria are single celled organisms with a unique internal structure.
Q: Which of the following enzymes relaxes the DNA double helix to avoid tensional force from supercoili...
A: DNA ligase:- DNA ligase works by catalyzing the formation of a phosphodiester bond between nucleotid...
Q: ds. QUESTION 9 For each of the following chromosome combinations in humans, what is the phenotypic s...
A: Gametes can be described as the reproductive cells comprised of sex determining chromosomes. The chr...
Q: Describe and identify on which segment of the legs/limbs would you expect the ambulatorial, fossoria...
A: Insects (from the Latin insectum) are hexapod pancrustaceans belonging to the class Insecta. They ar...
Q: A 12-year-old boy is brought in by his mother with a 2-day history of fever and generalized weakness...
A: Peeiorbital erythema : skin redness Edema : swelling Opthalmoplegia : abnormal eye movement that o...
Q: If the MRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3', then what is the corresponding...
A: Transcribing tRNA from mRNA, mRNA tRNA U A G C A U C C The above table can be used for...
Q: In a three-point testcross the nonrecombinant progeny are A+B+ C+ and a b c. The double crossover pr...
A: Three point cross refers to usinh three genes to determine order and distance between genes. During ...
Q: Which of the following are repeating disaccharides of polysaccharides are often found in mucus and f...
A: Mucopolysaccharides are polysaccharides (long chains of sugars) commonly found in the mucus or the f...
Q: out 1 in 1 d as an pused club ation, but person wh probabilit
A: In some cases, clubfoot can be associated with other abnormalities of the skeleton that are present ...
Q: What the grandparents' genotypes are? Why doesn’t the father (II-1) have the disease breast cancer?...
A: Genetic inheritance is the process by which genetic information is passed from the parents to the pr...
Q: Functional Group Name Structural Diagram (draw all bonds) Found where in the body??? Hydroxyl H -N H...
A: Functional groups can be described as the groups of molecules that get linked to organic molecules a...
Q: I may have the answer but I'm not sure
A: A crop is a plant or plant product that may be produced and harvested for profit or for food. Crops ...
Q: How could you describe the process shown below? Farming reduces forest area Deforestation reduces ra...
A: By examining the above process it can be concluded that the terms Diverging process and Neutral proc...
Q: For each of these things, say whether it describes the coding sequence or the regulatory sequence. T...
A: Coding sequences are sequences or portions of a gene or mRNA which codes for a protein. The coding r...
Q: While investigating the function of a specific growth factor receptor gene from humans, researchers ...
A: Growth factors work by engaging with certain cell surface receptors to control cellular proliferatio...
Q: What is adaptive immunity ?
A: Immunity is a complicated biological system with the ability to recognise and tolerate what belongs ...
Q: Please answer fast The phenotypes of organisms are products of genetics, environment, and gene x en...
A: Phenotype: it represent the physical properties of organism that can be observed. Phenotype includes...
Q: Kindly assist me with this one. I am really having a hard time writing an essay. Please. Thank you.
A: ANSWER: On 26 November 2021, WHO designated variant B.1.1.529 a variant of concern, following advice...
Q: a) Name and define the evolutionary processes that cause change in allele frequencies across generat...
A: a) There are five key mechanisms that cause a change in allele frequencies across generations. Muta...
Q: Trace the flow of hemolymph circulation in the insect circulatory system. Be able to explain how nor...
A: Insects, like all other arthropods, have an open circulatory system that differs from the closed cir...
Q: QUESTION 2 Which of these is a characteristic of adaptive immunity, but not innate immunity? O infla...
A: There is a battle for all living species to survive by conquering the complete harmful organism. The...
Q: One parent with the Achondroplasia phenotype and a normal parent have 2 children. Both children have...
A: Achondroplasia is a type of osteochondrodysplasia in which the cartilage at the ends of the limb bon...
Q: Please help Write a short sentence summary about taxonomy
A: Classification is very important in finding particular species of plant or animal in this vast varie...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: IgM vs IgG
A: Answer:
Q: The cuticle is a complex non-cellular layer secreted by the epidermis. It is the seat of complex pro...
A: 'Metamorphosis' is a natural mechanism in which creatures such as insects, amphibians, and a few aqu...
Q: If you were given the task of determining the approximate % solute of potato cells. You decide to se...
A: The process of osmosis is the transport of water or solute molecules across a semipermeable membrane...
Q: When doing science writing, it is okay to use direct quotes, phrases, or strings of words from anoth...
A: Science writing: it is a technical writing skills used by scientists and researchers to communicate ...
Q: You are told that the cells on a microscope slide are plant, animal, or bacterial. You look at them ...
A: Cell Cell is the basic functional unite of any organism.
Q: 2. which of these is the characteristic of prokaryotic cells? a. both of these b. do not posses true...
A: Phase contrast microscopy: The optical microscopy technique phase-contrast microscopy (PCM) translat...
Q: In German cockroaches, bulging eyes (bu) are recessive to normal eyes (bu+), and curved wings (cv) a...
A: Answer is e.bu cv+
Q: n Figure 4-19, what would be the RF between A/a andB/b in a cross in which purely by chance all meio...
A: ANSWER: Recombination frequency (θ) is the frequency with which a single chromosomal crossover will...
Q: Please answer in detailed explanation about these animal cloning questions a. What is animal clonin...
A: The term cloning refers to number of different processes that leads to production of genetically ide...
Q: он он GalNAC OH OH Gal но Он он CH,CONH B(1-) Gal a(13) a(12) O B(1-) H,C- но α(12) но L-Fuc H3C- A ...
A: In ABO system, there are four common blood groups are present; O, A, B, and AB. The blood groups are...
Q: Question:- How is the assembly of an antibody different than traditional forms of alternate splicing...
A: Introduction: The B lymphocytes, which are antigenically activated, undergo blast transformation to ...
Q: Achondroplasia is a hereditary condition caused by a dominant allele in humans (dominant allele A). ...
A: Achondroplasia Achondroplasia is a form of dwarfism in which ossification does not occur properly. ...
Q: answer the following question with in depth detail on habitat, lifestyles, and global distribution o...
A: Protists are eukaryotic organisms, they belong to the domain Eukaryota/Eukarya. Eukaryote organisms ...
Q: In normal tissues, which phase do cells capable of dividing spend most of their time in? Briefly de...
A: Introduction: Life is based on the cell cycle and cell division. Cell cycle and cell division are r...
Q: What are the factors which need to be considered in the selection of culture vessel?
A: Culture vessels:- Culture vessels provide a contamination barrier to protect the cultures from the e...
Q: Describe Brownian motion. What causes it? How does one differentiate between Brownian motion, water ...
A: Brownian motion or movement is that the uncontrolled movement of particles or zigzag pattern of move...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- Question:- A decrease in which of the following cells will lead to a parasitic infection? A. macrophage B. B cell C. T cell D. Natural killer cell please explain! i know that eosinophils fight parasites but which one could cause the parasitic infection if it decreased?Question- Which of the following is NOT a reason why SARS-CoV2 is so virulent? A. It attaches to a host cell receptor that is on many cell types B. It cannot be transmitted from an asymptomatic person C. It has a low infectious dose D. It is able to inactivate some portions of the human immune systemQUESTION 11 A graduate student, whom had not taken BIOL 531, localized the epitope for an antibody generated by the COVID19 vaccine to the peptide sequence below. S21P2 PSKPSKRSFIEDLLFNKV The student did a Blast search of the human proteome and found matches to human proteins. They are concerned that this means the vaccine could cause an autoimmune rection to human proteins. Is this student justified in this concern? Use statistics from a Blast search to justify your answer (Limit 5-6 sentences).
- Question:- Most WBCs of the adaptive immune system generally reside in either lymph nodes or the spleen in the absence of an infection. How do adaptive WBCs use their own surface proteins to migrate to these designated locations? Why would they be able to go to these designated locations whether an infection is occurring or not? How do these features of adaptive cells relate to their roles as slow responders with very precise specificity for non-self microbes?Question 27 The process responsible for the production of antibodies against allergens to ‘arm’ a mast cell is known as what? Question 27 options: Antigen processing Inflammation Sensitization HyperreactivityQuestion. If you are working in a diagnostic lab, what will be your choice among Monoclonal or Polyclonal Antibodies method for detection of specific pathogen? Give sufficient justification for selection as well as rejection of any given methods.
- Question 1 Nursing. Innate lymphoid cells reside primarily in tissues such as the lungs, the lining of the gastrointestinal tract, and the skin, because these sites represent the major routes of entry of pathogens into the body. Several different subsets of innate lymphoid cells exist, and each is specialized to respond to a category of pathogen (e.g., viruses, extracellular bacteria, helminthic parasites, etc). a) True b) FalseQUESTION 5 What do allergies to bee stings, transfusion reactions to improperly matched blood, and poison ivy reactions all have in common? harmful Ab responses involve degranulation of mast cells and basophiles involve immunodeficiencies involve T cells mediating a harmful response exaggerated and inappropriate immune responses Time remaining: 01 :58 :52 Anatomy and Physiology 1- Cytotoxic T cells express which of the following proteins on their cell surface? (Select all that apply) a. T cell receptor (TCR) b. CD8 c. CD4 d. B cell receptor 2- Which of the following statements is the most accurate concerning lymphocytes? a. T cells and B cells both express TCRs. These are the product of approximately 100 genes. Each lymphocyte expresses only one of the ~100 receptors coded for by these genes, and in the absence of clonal selection the liklihood that two cells express the same receptor is only moderate b. T cells and B cells express TCRs and BCRs respectively. These are the product of genetic recombination and can comprise one of millions of combinations. Each lymphocyte can express 1000s of different receptor variants, maximizing the likelihood that a single adaptive immune cell will recognize pathogen-associated antigens. c. T cells and B cells express TCRs and BCRs respectively. These…
- question: Can you summarize and explain for me what you want to tell in the article below? Can you explain the figure? When I read it myself, I do not understand exactly what is meant by the article. It would be nice if you could highlight the important points. You can use them in a figure or diagram to explain. thank you and hava a nice day :) Article: Nanotechnology Tools to Detect SARS-CoV-2 Standard procedures for detecting the virus from nasopharyngeal and/or oropharyngeal swabs have been reviewed recently and are primarily based on reverse transcription polymerase chain reaction (RT-PCR). Here, we would like to mention some preliminary ideas on nanotechnology-based assays to monitor the presence of SARS-CoV-2. A simplified test and variants thereof to detect viral proteins (e.g., HIV or influenza virus) without the need for expensive equipment is based on the color change of Au NPs bound to antibodies. Similar to the enzyme-linked immunosorbent assay (ELISA) antibodies coupled…question: Can you summarize and explain for me what you want to tell in the article below? When I read it myself, I do not understand exactly what is meant by the article. It would be nice if you could highlight the important points. You can use them in a figure or diagram to explain. thank you and hava a nice day :) Article: Photodynamic Inactivation of SARS-CoV-2 In addition to drug- and vaccine-based antiviral strategies, photodynamic therapy (PDT) stands as a unique approach to inactivate SARS-CoV-2. Using a light-based method, PDT attacks target cells via the excitation of photosensitive agents, called photosensitizers (PSs), with radiation characterized by a wavelength corresponding to its absorption spectrum to generate reactive oxygen species (ROS) in the presence of oxygen, which ultimately results in cell death. Photodynamic therapy is primarily used for the clinical treatment of various oncological disorders. It was not until the 1970s that PDT was first used clinically…question: Can you summarize and explain for me what you want to tell in the article below? When I read it myself, I do not understand exactly what is meant by the article. It would be nice if you could highlight the important points. You can use them in a figure or diagram to explain. thank you and hava a nice day :) Article: Nanomaterial-Based Vaccine Development and Immunomodulation Following the publication of the genetic sequence of SARS-CoV-2 on January 11, 2020, intense research efforts have been devoted to developing a vaccine against COVID-19. With unprecedented speed, this extraordinary scientific mobilization led the first vaccine candidate to enter the Phase I human clinical trial on March 16, 2020, and other novel candidates are rapidly following. Up to May 22, 2020, there are 10 COVID-19 candidate vaccines in clinical evaluations and 114 in preclinical development. Concerning vaccine and immunization research, nanomaterials can assist in multiple ways to boost the…