Question:- Explain how CO,-in dependence of light –regulates the transition to flowering. Include these transcription factors in your explanation: AP1, SOC1, CO, FT, LFY, FD.
Q: In your own words, Explain how can the Subject Personal Identification of Fingerprinting benefiting ...
A: Introduction: The technique which is used to identify and analyze the variation on the basis of vari...
Q: how do you explain behavior using brain dynamics?
A: The "nervous system", also known as the neural system, is a complicated network of neurons that are ...
Q: Explain the following statement: The O2 generated by photosynthesis is simply a by-product of the pa...
A: Photosynthesis is the process by which plants prepare their own food with the help of sunlight, wate...
Q: How does the transcribed mRNA convert into a functional protein?
A: Introduction: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulu...
Q: the following processes except a. alternative splicing to produce a secreted form of the T-...
A: Answer 1st answer - d) somatic recombination 2nd answer - d) CTLA4, SUPPRESSION
Q: What are the conditions that might cause a cell to halt the cell cycle
A: Introduction: A cell cycle is a set of events that occur in a cell as it divides and grows. A cell s...
Q: In fruit flies, brick-red eye color is dominant to a bright orange color called cinnabar. A fruit fl...
A: The correct Answer is C
Q: How can people effectively manage stress when diagnosed with cardiovascular conditions?
A: When people diagnosed cardiovascular conditions than how can manage stress
Q: Photosynthesis can be divided into multiple stages. What are the stages of photosynthesis, and where...
A: Photosynthesis refers to the biochemical process that occurs in the chloroplasts of plants to conver...
Q: Distinguish among inducible, repressible, and constitutive gene operons.
A: An operon is a cluster of functionally-related genes that are controlled by a shared operator, it is...
Q: what are the important words in the study of Nutrition
A: Nutrition It is the process by which body utilizes food for growth and maintenance and healthy livi...
Q: Given the DNA of the three organisms, determine the mRNA, IRNA, and the amino acids that correspond ...
A: There are 64 possible codon for four nucleotides out of 64 codon 61 code for Amino acids and 3 do no...
Q: In the absence of Separase, how would this affect the chromosomes dynamic during mitosis?
A: Separase is an ubiquitous cysteine protease enzyme which remain inactivated (by forming complex with...
Q: Most healthy body cells spend the majority of their lives in_____ . a. prophase d. telophase b. meta...
A: Introduction All living organisms are made up of cells, which are the basic building components. The...
Q: Question 6 When light hits the special light-reactive molecular units inside rod cells, how do these...
A: Answer 6- One bond shifts positions from cis to trans orientation Answer7- cephalopods evolved eyes ...
Q: unknown species? Make an output on how you can help in the protection of the unknown species in the ...
A: A species of animal or plant that is seriously at risk of extinction are called endangered species.
Q: Instruction: The answer must be in minimum of 2 paragraphs and each paragraphs must have a minimum o...
A: Sex is a trait that determines an individual's reproductive function, male or female, in animals and...
Q: Explain the four classification schemes of streptococci species
A: streptococci are gram positive bacteria, having spherical or oval coccus aligned in a chain form. Th...
Q: 6 Question 6 ECM lysosome flagellum microtubule centrosome rough ER smooth ER nucleolus nuclear pore...
A: A diagram of animal cell is given. Have to label various organelles and parts of animal cell.
Q: Gymnosperms vs. Angiosperms 1) The gymnosperm seed results from and an angiosperm seed results from ...
A: Gymnosperms These are seed-producing plants such as conifers, gnetophytes, cycads, etc. Angiosperms ...
Q: 1.) Propose the biosynthesis of 5-methylorsellinic acid: CH; НО CH3 `CO,H OH
A: 5- methylorsellinic acid is a dihydroxybenzoic acid. That is O-orsellinic acid in which the hydrogen...
Q: Ronald was the victim of an assault and has symptoms of posttraumatic stress disorder as well as dep...
A: Post-traumatic stress disorder is one of the serious and rare disease. In this disease mental and be...
Q: Describe the bacterial colonies providing information on shape, color, size, elevation and edge appe...
A: Different types of bacteria form different types of bacterial colonies which differ in their morphol...
Q: Describe the bacterial colonies providing information on shape, color, size, elevation and edge appe...
A: *morphology of Escherichia coli is identified as rough or a smooth form. *The trough forms colonies...
Q: QUESTION 17 Neurotranamtes Can induce Ca** flux in a muscie cell and thus muscle contraction are eff...
A: Answer 17) C- neurotransmitters are released at the synapse
Q: Draw cells in 4 large squares of the hemocytometer showing: 48 total viable cells (hollow dots) 9 t...
A: Hemocytometer is a counting- device used for counting blood cells. It is a glass slide with a cover ...
Q: Mitosis and cytoplasmic division function in .a. asexual reproduction of single-celled prokaryotesb....
A: Mitosis and cytoplasmic division are described as a process where the cell of an organism is divided...
Q: compare these two techniques. Compare a nucleosome protection assay and a northern blotting is a tex...
A: Introduction: The nucleosome is the fundamental subunit of chromatin. Each of the tiny beads are cal...
Q: Does the mechanism of recombination of unlinked genes require crossing-over? Explain your answer.
A: No, the mechanism of recombination of unlinked genes does not require crossing-over.
Q: You counted 40 colonies on a plate in your dilution series. The plate was inoculated with 1.0ml from...
A: A microbial sample will have enormous amount of cells. To estimate this by calculation, the sample i...
Q: (n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne...
A: Permutation infers the maximum number of possible arrangements by given things/ variables that can b...
Q: Photosynthesis is defined as the chemical process, wherein carbon dioxide in the presence of water a...
A: The plants have three basis needs to grow better. These are, 1) Sunlight 2) Water 3) CO2 Along with ...
Q: Describe the bacterial colonies providing information on shape, color, size, elevation and edge appe...
A: Nutrient Agar is used for the cultivation of bacteria and for the enumeration of organisms in water,...
Q: INTRUCTIONS: Place a check on the box if the organ/structure is present in billy goats/bucks. Leave ...
A: Male reproductive system of bucks The male reproductive system consists of testicles,which produce s...
Q: What is the nature of the targeting sequence, and what distinguishes it from other types of targetin...
A: Introduction In the cell, there is a highly regularized transport mechanism that works for the tran...
Q: Fires (bushfires/wildfires) are a natural occurrence in grassland communities. Discuss why it is an ...
A: Natural occurrences have a great impact on several ecosystems. There are many advantages and disadva...
Q: the photos below show flowers from two Arabidopsisplants. The plant on the left is wild-type (unmuta...
A: Arabidopsis thaliana is used in Alexander bruan experiment to explain the double flower mutant conce...
Q: MATCH EACH WITH THE LETTER. 1. RIBOSOME 2. NUCLEUS 3. ROUGH ENDOPLASMIC RECTICULUM (ER) 4. SMOOT...
A: Matching of cell organelles with their functions :-
Q: A collection of similar species a. family b. order c. kingdom d. genus
A: Since you have asked multiple questions , we will solve the first question for you. If you want any ...
Q: Identify the type of flagella from the picture
A: Introduction :- Flagella are the locomotory structures which are present of the cell surface and all...
Q: Ronald was the victim of an assault and has symptoms of posttraumatic stress disorder as well as dep...
A: The diagnosis of the disease is very important in medical science. It helps in proper treatment and ...
Q: Dinosaurs like edmontosaur how do they defend themselves from predators like trex? Trex has most pow...
A: Paleontology is the study about fossils and it grouped the living things present at that time and th...
Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...
A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...
Q: Describe crossing over and how it introduces variation in traitsamong the offspring of sexual reprod...
A: The offspring of sexual reproduction inherit genes from both parents. Furthermore, the offspring pro...
Q: Which of the following characteristics of a water-insoluble substance is most important in governing...
A: The solubility in water of molecules is the tendency of molecules to gets dissolved in water. The ch...
Q: I. List the sequences of RNA that would be transcribed from the following DNA template sequences. а....
A: Transcription is the initial stage in gene expression, when genetic information is utilised to build...
Q: The membrane potential in animal cells, but not in plants, depends largely on resting K+ channels. H...
A: Ion channels are the membrane proteins that mediate the movement of ions across the membrane.
Q: After adding ammonium sulfate, the mixture was allowed to stand with occasional stirring for 30 minu...
A: Salting out refers to the decrease in solubility of proteins in the presence of very high salt conce...
Q: 1. The histones that form the tetrasome. 2. The histones added to the tetramer to form the oc...
A: Histones are proteins responsible for DNA packaging, they are positively charged and so can easily b...
Q: A 60-year-old woman with history of lung cancer is admitted for weakness and lethargy for 4 weeks. H...
A: The correct option is C.
Question:-
Explain how CO,-in dependence of light –regulates the transition to flowering. Include these transcription factors in your explanation: AP1, SOC1, CO, FT, LFY, FD.
Step by step
Solved in 2 steps
- Predict the phenotype of a flower in whichAPETALA-2 (activity A) and AGAMOUS (activity C) are expressednormally, but APETALA-3 and PISTILLATA (activity B) areexpressed in all four whorls.Question:- What would be the effect on flowering time of over-expressing VIN3 (i.e., 35S:VIN3) in a winter annual Arabidopsis plant grown adjacent to a summer annual wild type plant in long days under warm conditions? Assume that the plants germinate at the same time. In answering the question, describe the molecular mechanism that allows you to make this conclusion.Biosynthesis of nectar and nutrient-rich pollen is energetically very expensive for a plant. Yet, plants funnel large amounts of energy into animal pollination. What are the evolutionary advantages that offset the cost of attracting animal pollinators?
- EXPERIMENT 4: INDUCTION OF CALLUS SOMATIC EMBRYOGENESIS OF HAPLOID PLANTS Objective: To prepare anther as a source of explant To induce callus somatic embryogenesis of haploid plants Procedure: Cut off the buds and sort them into 3 developmental stages based on length of buds Surface sterilize the buds in 70% ethanol for 2-3 minutes, making sure the entire bud is immersed in the alcohol. Drain off excess alcohol from the buds and aseptically excise the anthers from each bud. Remove the filaments and culture the anther on one of the agar media provided. Label the stage of development of the bud on each petri dish as the anthers are cultured. Seal the Petri dishes with parafilm. Incubate in the dark at 26 to 28ºC for 4 to 8 weeks or until small plants can be seen growing out of the anthers. Then transfer to diffuse light. Record the results of the experiment in table form and submit the report. Observation: The culture was contaminated after 8 weeks of incubation…in flowering control of plant, describe a situation wherein there are mutations in at least one or all of the genes responsible for control of the floral development.Using the provided figure, describe the importance of the two phytochrome systems in controlling de-etiolation and green stem elongation under full sun and shade. Include the key mechanisms and temporal changes in control of this process.
- Plant Physiology In the amazon rainforest, what is needed (1 only) to induce germination faster? Why?GENETICS - Physical characteristics of heredity - Discuss the characteristics observed in ONION ROOT TIP in each mitotic phase.EXPERIMENT : INDUCTION OF CALLUS SOMATIC EMBRYOGENESIS OF HAPLOID PLANTS Observation after a few weeks: The cell culture has been contaminated as shown in the image section. Question: Please give the source(s) of contamination in this experiment and the way(s) to prevent it.
- Will a long-day plant (LDP) bear flowers after it was subjected to nights interrupted by flashing red light followed by far-red light? *Question:- Which of the following is FALSE about fruit? A. Mature ovary B. Protect seeds and aid in dispersal C. Exposes the seeds D. Produced by flowering plantsQUESTION 10 Which is true regarding plant reproduction? Self-pollination produces offspring genetically identical to the parent modified organs, such as corms and bulbs, are produced as a result of sexual reproduction cross-pollination allows plant populations to survive in unstable environments plants do not reproduce asexually vectors such as flies carry plant spores to new locations