Animals in the phylum Mollusca exhibit (choose the correct answer) Question 7 options: segmentation. bilateral symmetry. no cephalization. endoskeleton.

Q: . Sketch the outline of a human body, and use linesto indicate an example of each of the…

A: Sagittal plane- it is a vertical plane that runs from front to back. Hence it divides the body into…

Q: Several calibration curves were created for a series of protein standards of known molecular mass…

A: Introduction :- Chromatography is a laboratory method used in chemical analysis to separate a…

Q: If an enzyme is functioning at 75% of Vmax, the substrate concentration must be than the Km of the…

A: Introduction: Proteins called enzymes aid in accelerating the body's chemical reactions, or…

Q: List ways in which we can conserve water to minimize negative environmental impacts.

A: All Earth's inhabitants depend on water as a valuable resource. Water is essential for life, but it…

Q: List the four most abundant elements in thehuman body

A: In the human body, four elements are present in high quantity. More than 99 percent of elements are…

Q: What's the most fundamental basis for animal behavior? A. Neurotransmitters B. Activation or…

A: The scientific study of the animal behaviour in there natural habitat is known as Ethology. It helps…

Q: When do sex hormones first exhibit an effect on sexual development?

A: Sexual development refers to the changes that occur in the body as we progress from puberty through…

Q: Answer briefly and concisely. Thank you! What have you observed regarding the brightness of the…

A: A microscope is a laboratory instrument used to examine objects that are too small to be seen by the…

Q: Describe what is meant by prostate cancer cell and stromal interactions for carcinogenesis.

A: A prostate cancer is a type of cancer that occurs in the prostate. It produces seminal fluid in…

Q: Fourteen NADPH molecules are required to produce one molecules of palmitic acid from acetyl CoA.…

A: Introduction  Fatty acid synthesis is the process by which fatty acids are produced from acetyl-CoA…

Q: 3. The following descriptions are for the components of oxidative phosphorylation. List the name of…

A: The Kreb’s cycle, the electron transport chain and the process of glycolysis are the most crucial…

Q: Do blind people dream in visual images?

A:

Q: Using your fingers, you are asked to aseptically touch the surface of a sterile agar plate.…

A: The aseptic technique of plating on an agar plate means that a sterile or no infection-containing…

Q: How about the top two reasons why layering procedures should be used? Provide evidence by citing…

A: Layering is a technique used for the propagation of plants. In this procedure, a stem developed…

Q: Mention the chemical change that proinsulin undergoes, to be able to act as mature insulin.

A: Pancreas is considered as both exocrine as well as endocrine gland. As an exocrine gland , it helps…

Q: Bob is a 19-year old male, who is 6’3”, and weights 160lbs. You tested Bob’s 1.5-mile run time, and…

A: The amount of oxygen you breathe in litres per minute is your absolute VO2 max. This quantity relies…

Q: Case Study: Case Study: Catalase Activity Catalase HO2 (0 + O, (9) Catalase is an enzyme that…

A: Enzymes are catalysts of biological systems that are used to accelerate the rate of a chemical…

Q: What is metabolism, and how are different types of energy useful for metabolism? Explain the three…

A: Metabolism is referred to as all the chemical reactions that take place inside a living body and…

Q: The controlled exposure condition applies to the general public with no time restrictions. Select…

A: Controlled exposure means exposure to various ionizing radiations that include X-rays, gamma rays or…

Q: Living things and molecular biology are used in the science-based industry sector of biotechnology…

A: Although numerous technological and biological advancements over the years ultimately contributed to…

Q: 2. Viruses a. Are viruses living organisms? Why? i. Give the properties of a virus that would…

A: The living world comprises of the Plants, the Animals and the Microorganisms. The microorganisms are…

Q: Which of the following describes the effect of the venom on the prey of the cobra?

A: Introduction Muscle contraction is a result of action potential generated by depolarization,…

Q: Define atomic number, atomic weight, and isotope

A: Atomic number, Atomic weight, and isotope are terms that are related to chemistry. All this…

Q: Adaptations for low oxygen in – inverts, goldfish, turtles

A: Inverts:- all those organisms lacking vertebra column comes under the category of inverts i.e.…

Q: Replicate this strand of DNA: GCA TAG CAA TGC

A: Replication is the process of production of identical copy of DNA strand by making complementary…

Q: A rubbery secreted matrix of proteoglycans and collagen surrounds living cells in______ . a. bone c.…

A: Roadeo glycans are made up of proteins and carbohydrate residues. Mainly ground substance of few…

Q: Discuss how modern agriculture can be changed to minimize environmental impacts.

A: The ways in which modern agriculture can be changed to minimize environmental effects are-…

Q: A man and his wife are both heterozygous  for brown eyes. They have ix children all of whom have…

A: Genetic Recombination:  The exchange of genetic material between distinct organisms, commonly…

Q: Consider the following genetic map from Mischievous gremlinus: A 6.0 CM H B + 13.4 CM C Interference…

A: Three genes control three traits in the mischievous gremlinus. Alleles A, B, and C represent the…

Q: Why does bladder exstrophy occur?

A: Urinary bladder is a part of excretory system that tends to store urine till it is passed out…

Q: A father has Type AB blood and the mother has Type O. What percentage of their offspring would you…

A: 50% of the offspring can have Type A blood and 50% can have Type B blood. None will have blood group…

Q: Match the description with the correct term. the idea that different mating calls of birds used…

A: Introduction Evolution refers to the change of characteristics of a population that can be inherited…

Q: Parent Cell(2N) Mitosis(2N) Meisios(n) 46 a. b. c. d. 6 Please Complete the…

A: Mitosis and Meiosis are essentially two kinds of cell division. Whenever a mother cell splits into…

Q: Name the products of the citric acid cycle.

A: The citric acid cycle is also known as the TCA cycle. The TCA cycle occurs inside the mitochondrial…

Q: Detailing the achievements and challenges to public health in the 21st century and discussing what…

A: Public health  It is defined as "the study of avoiding disease, extending life, and promoting health…

Q: metabolic scope

A:

Q: Describe the settings in which the reversed process of proliferation and differentiation is…

A: Cell proliferation can be described as a process of exponential growth and division of cells for…

Q: 3. Match the parts in Column A with its function in Column B. Write the letter on the blank…

A: Introduction The circulatory system is also known as cardiovascular system. The components of…

Q: What distinguishes the human visual system's temporal characteristics from its optical…

A: Introduction Vision is one of the five senses in human beings. Photoreceptors are responsible for…

Q: quality control, quality assurance, and quality management)

A:

Q: Why are there three layers of stomach muscle and how do they function?

A: The stomach is J shaped organ that is present in the upper abdomen on the left side of the body. The…

Q: Which of the following is based on the interactions of species with their abiotic environment?a.…

A: Introduction An ecosystem deals with both biotic and abiotic factors and their interaction with each…

Q: To దరరంహం సంద ఈ (A) The blue trait is inherited as an autosomal recessive trait which means that…

A: The pedigree analysis helps us to understand the inheritance of a particular disease by observing…

Q: QUESTIONS TO ANSWER: 1. Basic Microscopy 1. State 3 ways to handle the microscope properly.

A: Microscopy:- it is a technique used to magnify or enlarge the images of very small size objects such…

Q: Instruction: Go outside and observe your surroundings. From your observation, formulate a hypothesis…

A: INTRODUCTION Green plants and other certain autotrophic organisms synthesize their own food material…

Q: For the following problem: Identify the gametes for each parent, build a Punnett Square of the…

A: In genetics, Punnett square is a special type of square diagram, which is used to predict the…

Q: Summary 1. Explain the results of alcoholic fermentation for Tubes A, B, and C. Tube A Tube B Tube…

A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…

Q: Where are electrons, protons, and neutrons located inan atom?

A: Electrons, Proton, and neutrons are Atomic particles. Every atom contains an electron, Proton, and…

Q: What role does biodiversity play in the energy flow of ecosystems?

A: Ecosystems sustain themselves by recycling nutrients and energy from outside sources, such as the…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Animal Phylogeny

Cladistics is a method of biological classification where organisms are classified based on their ancestors and their relationship with them. It is defined as the concepts and methods for determining the branching patterns of evolution and evolutionary history. Some scientists, however, have preferred the term phylogenetic systematics or phylogenetic taxonomy to emphasize the reliance on a phylogeny for classification. It is the most common and accepted method for classifying organisms.