Answer this question, well detailed with a lot of information filled in. It is important to answer with more than 700 words please!!. 1.Create a table or graph of your choice to illustrate the difference in the size of the beluga population over a period of your choice. Explains the reasons why the size of the population is affected.

Q: In terms of classification, what are the 5 unique characteristics that place animals in the Phylum…

A: Kingdom Animala consist of many phylums. Mollusca is the second largest animal phylum and consists…

Q: 11. What is the role of photosynthesis that links plants and animals? 12. If the enzyme RuBisCo is…

A: Metabolism is a phenomenon takes place inside the living cell in which formation of large new…

Q: A child complaining of rectal itching and insomnia is most likely suffering from pinworm hookworm…

A: Introduction A parasite is an organism that lives in another organism, called the host, and often…

Q: trace the development of a megapspore mother cell to the formation of mature embryo sac in a…

A: The development of a megaspore mother cell to the formation of a mature embryo sac is a critical…

Q: 10) If a person breaths air which is contaminated with a radionuclide at a concentration equal to 1…

A: MPC is the maximum permissible concentration of radionucleotide is the maximum permissible limit of…

Q: what would happen to the action potential if the potassium channels opened before the sodium channel

A: Neurons and muscles have cells that generate an action potential in response to stimuli. These are…

Q: what are the phenotypes of individuals #3 and 4?

A: A dominant phenotype is an observable trait that is determined by a dominant allele, which means…

Q: Answer the following: Synonyms/Latin Nmaes of Acacia Mucilage Therapeutic Classification of Acacia…

A: 1) The Synonyms/Latin Names of Acacia Mucilage are- Mucilago Acaciae, Gum Arabic, Goma Arabiga,…

Q: In mice, grey coat is dominant: albino coat is recessive. A grey mouse mated several times in…

A: Understanding patterns of characteristics transmission requires knowledge of the fundamental…

Q: What advantages are there to using plant associated microorganisms rather than animal associated…

A: Xanthan gum is a polysaccharide food ingredient derived from the bacterium Xanthomonas campestris…

Q: 1. A person kept a diet without proteins for a long time, severally limiting proteins in food. In…

A: Introduction Various biomacromolecules like proteins, carbohydrates, along with vitamins and…

Q: What are the observed genotypic frequencies for Wildrose at the pt-8 locus? and What are the…

A: The observed genotypic frequencies for Wildrose at the pt-8 locus are: 0.25 for PP, 0.50 for Pp, and…

Q: You isolate ten new mutant yeast strains that are defective in synthesis of leucine, an amino  acid.…

A: In this scenario, you have isolated ten new mutant yeast strains that are defective in the synthesis…

Q: Mrs. Kaur and Mrs. Sharma had babies on the same day at the same hospital. Mrs. Kaur took home a…

A: Introduction :  There are four types of blood groups in humans in case of ABO system. These are A,…

Q: List the steps involved in neurotransmitter release starting with depolarization and ending with…

A: Neurotransmitter release is the process by which a neuron releases chemical messengers called…

Q: RUFF! MY EARS ARE DOMINANT! Dihybrid Crosses - Problem 2 THIS ONE ISN'T REAL (DOG EARS / COLORING…

A: In problem it was given that allele for floppy ears is dominant to pointed ears.  floppy ears…

Q: Patient is in severe stomach distress and is unable to swallow any meds due to vomiting, precise…

A: There are several routes of administration for drugs, including: Oral: This is the most common…

Q: Which of these describes the symptoms of the disease(s) caused by mutations in KMT2D ? Select all…

A: For a protein participating in a critical biological activity, such as DNA synthesis or cell…

Q: What is knockdown gene analysis? How is this different from knockout analysis?

A: Gene knockdown is a method in which temporarily stop or decrease the expression of one or more…

Q: Mutations:  The codon GGA encodes the amino acid glycine.  Identify the type of mutation for each of…

A: Central dogma is a very basic procedure of producing proteins.In this process mRNA plays a vert…

Q: The very high levels of Iridium at the KT boundary was confirmed in different parts of the world and…

A: KT boundary stands for cretaceous tertiary boundary and it marked the end of the mesozoic era.…

Q: A cell has evolved in an environment that lacks a particular food source. However, when given this…

A: Lac operon:  In E. coli and other enteric bacteria, the lactose operon (lac operon) is required for…

Q: discuss at least five different examples of extremophiles on Earth and discuss how they thrive in…

A: Introduction Extremophiles:- Extremophiles are the microorganisms that thrive within the extreme…

Q: What would be 1 or 2 good biology careers for Phylogeny, modern taxonomy, fungi, plants, and…

A: Phylogeny: This is the study of the evolutionary relationships between different species and groups…

Q: What is polyspermy and how is it achieved or inhibited in human fertilisation? Using a flowchart…

A: Polyspermy is a phenomenon where an egg is fertilized by more than one sperm. In human…

Q: 11 2. Copy the following table in your notebook. Complete the table by • identifying the…

A: Introduction :  Infection, presence, and proliferation of pathogenic (able to cause disease)…

Q: Activation of the beta-gamma subunit associated with the Go protein complex would lead to what…

A: Ans) Closing of presynaptic Ca++ channels Option 1 is correct because the activation of the Go…

Q: how does genetic engineering help us grow oranges?

A: Genetic engineering is a biological process in which transgenic or genetic modified individuals are…

Q: Read the Guilty dentist information. Then use your understanding to answer the following question:…

A: A diagrammatic representation of biological entities related via common descent, like species or…

Q: what are the 3  names for e coli bacteria and cactus

A: Bacteria are single-celled life forms belonging to the domain prokaryote as they lack proper…

Q: Pharmaceutical buffers and examples

A: A buffer is a type of solution that can resist the pH change upon the addition of an acidic or basic…

Q: 8. Which monosaccharides a. b. C. d. make up sucrose? glucose and fructose galactose and glucose two…

A: 1.We all know that carbohydrates are of different types based on the number of sugar molecules like…

Q: Which of the following general transcription factors are indicated as "minimally required" for…

A: Transcription factors are proteins that "bind to promote areas and aid in the initiation of…

Q: In what 2 ways is an insect's circulatory system different from a vertebrate's circulatory system?…

A: Circulatory system which is also known as blood vascular system is chiefly associated with transport…

Q: 6. Define which of the following results (pH, HCO³ mmol/l, Pcomm Hg) take place in a patient who…

A: Smoking is a leading cause of preventable deaths worldwide and is linked to a variety of health…

Q: An enzyme speeds up a chemical reaction by reducing the number of hydrogen bonds amount of electrons…

A: Ans: Enzymes are the protein bodies that act as biological catalysts and help in speed up the…

Q: Do you think that the digestive system of humans is similar to those of other animals? Where might…

A: In humans and animals, digestive system break down food so that it can be used by the body. Humans…

Q: During the action potential waveform, the voltage returns to the resting membrane potential at -70mV…

A: An action potential is a rapid change in the electrical potential of a cell membrane, caused by the…

Q: how many nucleotides are in CAGATTGTGAAGAGGTCTCTTGA consensus coding sequence? Answer in numerical…

A: Nucleotides are organic molecules made up of a phosphate and a nucleoside. They function as…

Q: Mendel's law

A: Gregor John Mendel is called the father of genetics as he give his famous three laws of genetics…

Q: Talk about the concepts of gene number, organismal complexity, and the C-value paradox. Give…

A: The concepts of gene number, organismal complexity, and the C-value paradox are all related to the…

Q: What conclusions can be drawn from the table ?

A: Introduction- The Cardiac CycleRefers to the events of 1 complete heart beat- Both atria &…

Q: Determine the population size of beluga in Canada. Explains with which sample scientific researchers…

A: introduction: The term "canary of the sea" refers to the white hue and variety of vocalisations of…

Q: Which of the following statements is NOT true of biological organic molecules? Their atoms are…

A: Biological organic molecules or biomolecules are the molecules that are needed by enough amount for…

Q: Which of the following is an important model organism for studying development? a. E.coli O b. D.…

A: Model organisms:         When the process of development is studied in detail the model organisms…

Q: Part III-PGD? Suzanne and David decided to have children. They wanted to ensure that their children…

A: NOTE: according to the answering guidelines, I am going to answer only first question. Please post…

Q: Macromolecule Carbohydrates Lipids Proteins Nucleic Acids Monomer Amino Acids Elements Present C,H,O…

A: Large, naturally occurring cellular components known as biological macromolecules perform a number…

Q: In this diagram, which of the following is TRUE? H+ (proton) Organic molecule that includes two…

A: Option B ) The NAD+ becomes reduced.

Q: Color blindness is a recessive trait on the X chromosome. What are the genotype and phenotype ratios…

A: X-linked characteristics are those that are influenced by genes found on the X chromosome. The…

Q: As of E. O. Wilson's 2002 interview, what was the number of people on Earth?

A: E.O. Wilson He was a scientist and writer who performed ground-breaking work on biodiversity,…

Marine Evolution

Marine habitat is less explored, and hence, its biological diversity is far less known. The marine habitats are not constant due to their shifting nature, while the terrestrial habitats are more stable. Marine biology is the science that deals with the study of diverse marine species, their interactions, and behavioral characteristics.