arasympathethic stimulation of the lungs causes   bronchi to dilate bronchioles to dilate bronchi to constrict bronchioles to constrict

Q: in the fruit fly, genes for rRNA can be replicated more or less often compared to the rest of the…

A: The regulation of the quantities of protein generated from its mRNA is known as translational…

Q: 1.Which mechanism of evolution (selection, drift, mutation, non-random mating, or gene flow) do you…

A: Evolution is the process by which one species changes over time/generations in terms of various…

Q: List the four distinguishing chordate traits.

A: Chordate contains two classes of invertebrates and one class of vertebrate. Invertebrates include…

Q: Identify three characteristics used to classify viruses.

A:

Q: The concept of endosymbiosis as applied to chloroplast and mitochondria found in eukaryotes: a) is…

A: Endosymbiosis is a kind of relationship in which one organism enters in an another organism. The…

Q: please arrange the statements in rpoper order

A: RISC  is an RNA-induced gene silencing complex. Argonaute proteins are endonucleases, the active…

Q: 17 Refer to the table. Reaction Chemical equation (kcal/mol) 2 glucose → maltose + H₂O +4.0…

A: The chemical reactions take place with the change of energy. The spontaneous reactions release…

Q: Alternative splicing of the same pre-mRNA produces two isoforms.

A: 30) During RNA splicing , the introns are precisely excised and exons are ligated together. However…

Q: In eukaryotes, fatty acids are stored as triglycerides in cells that have: A) Golgi that store…

A: Triglycerides are the substances produced by dehydration and is executed in cells having the…

Q: Give a brief description of a typical eukaryotic cell cycle, indicate during which phase DNA…

A: * cell cycle consists of four phases . They are  G1 phase  S phase G2 phase  M phase * During G1…

Q: Suppose you are to design an experiment for the following problems, identify the independent…

A: A research proposal is a document that specifies the aims of the research and the techniques that…

Q: Which figure represents competitively inhibited enzyme? Substrate Substrate Substrate Enzyme…

A: Enzymes are proteinaceous molecules which when added up into the reaction , accelerates the process…

Q: The figure below shows the recognition sequences and cleavage positions of three restriction…

A: Restriction enzymes are those that have a tendnecy to cut the strands of DNA straight. This leads to…

Q: Infer how COVID19 RNA might be replicated in human cells. Use the following RNA sequence (the  sense…

A: RNA-Seq (acronym for RNA sequencing) is a sequencing technology that employs next-generation…

Q: The ____and_____ are grouped as Ecdysozoabecause they both molt.a. cnidarians/arthropods c.…

A: As they mature, all members of Ecdysozoa superphylum molt or lose their cuticle. They secrete a…

Q: Describe the anatomical and physiological adaptations that aroseduring the transition to life on…

A: Life evolved underwater so the earth was totally covered with water at the beginning of humankind,…

Q: Unhealthy diet problem Possible Solutions (List of Different Solutions) What are the possible…

A: An unhealthy diet may cause several diseases but there are several solutions for this, a few of them…

Q: Please answer asap and in short and content should not be palgarised please This field is a…

A: ANSWER;- D) biotechnology Explain;- Biotechnology is the utilization of science to take care of…

Q: In the US, many farmers regularly use the herbicide glyphosate to keep their fields free from weeds.…

A: Natural selection is proposed by Charles Darwin. The main concept here is the process through which…

Q: 1. Methylation of DNA and acetylation of histones are inversely correlated. II. Methylation and…

A: The simplest physical as well functional component of heredity is the gene. DNA can be referred to…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…

A: As per our Guidelines we are not allowed to answer more than three sub parts at a time.

Q: Why are mRNA vaccines more effective than conventional vaccines?

A: Introduction :- A vaccine is a preparation that stimulates the body's immunological response to…

Q: In order for the Golgi apparatus to release synthesized molecules to the outside of the cell…

A: The proteins synthesis in the cytosol or RER membrane need to be translocated to their respective…

Q: In control of ventilation, which of the following is the most important?   PCO2 in the blood PO2 in…

A: The physiological systems involved in controlling breathing, or the passage of air into and out of…

Q: The fact that a prokaryote has the ability to make a new protein that is placed in the cell membrane…

A: Prokaryotes are organisms in which cell do not have nucleus and organelles.  Prokaryotes are further…

Q: A dominant gene that codes for white hair is represented by the symbol W. If a parent with the…

A: The dominant trait is the one that first appears or is visibly seen in organism. Even if only one…

Q: How to prepare an agar plate for bacteria? How to include the antibiotics into agar plates? How long…

A:

Q: Explain what will happen to the products of replication if DNA polymerase I is absent.

A: DNA polymerase Group of enzymes that catalyse the synthesis of DNA during replication. Prokaryotic…

Q: Why can’t new viruses be completely assembled in the nucleus of the host?

A: Viruses cannot entirely replicate in the nucleus since all the translationary machinery is in the…

Q: None of the above Which of the following is amphipathic? O Phospholipids. O Integral proteins. O…

A: Introduction :  Membrane lipids are amphipathic in nature. It has polar head and non polar tail.…

Q: ______include the only winged invertebrates. a. Cnidarians c. Insects b. Echinoderms d. Crustaceans

A: Introduction :- Invertebrates are animals that do not have or develop a vertebral column, which is…

Q: with spines b. with thorns c. with stinging trichomes d. with cutin or waxy leaves  Plants to…

A: Physical defense are a first line of protection for some plants. These defense make it challenging…

Q: 29. Sympatric speciation describes populations that a have sexual dimorphism b) look the same…

A: Question number 29. The type of speciation where reproductive isolation occurs between the…

Q: 1. Briefly describe the affect of the glutamic acid to valine mutation on the Hemoglobin protein as…

A: Answer

Q: Given that COVID19 has a single strand RNA for its genome, the number of rounds required to complete…

A: COVID 19 is a SARS virus which causes epidemiological disease called corona virus.

Q: structures of organic compounds allow them to function as pigme

A:

Q: What purpose do scaffolding proteins serve in binding to Map kinase enzymes?

A: Introduction :- MAPKs are serine/threonine kinases that activate a variety of cytoplasmic and…

Q: I. Individuals diagnosed with autism can have reduced expression of the oxytocin gene due to…

A: The majority of mutations develop when the DNA fails to duplicate correctly. All of these mutations…

Q: Questions 3 and 4 refer to the following diagram. Tertiary Consumer Snake Secondary d Consumer Toad…

A: The strata is very important in various ecological cycles as it keeps the consumers and producer…

Q: in the human beta-globin, two introns are spliced out in order to produce the mature mRN

A: The gene regulation can be exercised at different levels where DNA can be packed tightly or loosely…

Q: Components Low blood sugar level High blood sugar level sensor G-protein-coupled receptors (GPCRS)…

A: The control of blood sugar by insulin is an example of a negative feedback mechanism. Glucose…

Q: In the very first round of PCR using genomic DNA,the DNA primers prime synthesis that terminates…

A: It is a quick and versatile in vitro molecular biology technique for amplifying the defined target…

Q: tight packing of previously less condensed chromatin   identify which describes the statement…

A: Post translational modifications in histone proteins can change the shape of chromatin, which can…

Q: The capsid of a virus consists of (a) protein subunits (b) nucleic acid (c) helical lipids (d) a…

A: Introduction:- Virus is a small, simple infectious agent that can only multiply in live cells of…

Q: А D

A: Bones joins to form skeleton of body.  Bones made from osteocytes cells, calcium & phosphates.

Q: All UI the above Passive facilitated transport across a biological membrane: uses an integral…

A: Introduction :  Facilitated trabsport is a type of passive transport i.e no need of energy to…

Q: metabolize aerobically and anaerobically. refers to pathways that take place in the presence of…

A: The human body needs glucose to make adenosine triphosphate (ATP) molecules during the aerobic…

Q: Many drugs work by interfering with the inactivation of neurotransmitters once they gave been…

A: The body possesses several chemical messengers which are known as neurotransmitters. These…

Q: CGG CCA UGU AUA UAA Enter your answer as a string without dashes, using three-letter abbreviations…

A: DNA ( Deoxyribonucleic acid) is a ladder like helical structure which serves as genetic material in…

Q: In some wasps, the workers are more related to the sons produced by workers than to the sons…

A: * wasp colonies made from chewed wood and saliva which can be found hanging on trees or leaves.…