CGG CCA UGU AUA UAA Enter your answer as a string without dashes, using three-letter abbreviations for amino acids. Use STOP for stop codons and STAR" for start codons.
Q: Evolution of what biological process is hypothesized to have been made possible by the appearance of…
A: Introduction :- Chlorophyll is a group of green pigments found in the mesosomes of cyanobacteria and…
Q: Select all that apply to root-associated fungi a. arbuscular mycorrhizal fungi cross the plant…
A: Soil is a thin layer of matter that forms on the earth's surface as a result of the processes such…
Q: Endocrine Ligand acting on intracellular rec should be: O Hydrophilic O Hydrophobic O Amphipathic O…
A: Ligand is a specific molecule which binds to its receptor. These receptors are of two types…
Q: 1-________terms describe the form of bacterial colonies on nutrient agar plate. 2- ______ is a terms…
A: INTRODUCTION A growth medium, also known as a culture media, is a liquid or gel that helps bacteria,…
Q: The presence and orientation (direction) of integral glycoproteins indicates that the plasma…
A: The plasma membrane is also known as the Cell Membrane. It is a vital component of a cell that…
Q: Explain how transcription and translation may or may not be altered by a virus such as West Nile…
A: INTRODUCTION The West Nile virus belongs to the Flavivirus genus. Flaviviruses reproduce in the…
Q: O O When CAMP is formed, it will activate: O Protein Kinase C O Protein Kinase A O G-protein O…
A: Cyclic adenosine monophosphate, also known as cyclic AMP or cAMP, is a small, hydrophilic…
Q: Briefly describe what primer dimers are, its formation, how it migrates on an agarose gel, and steps…
A: Gel electrophoresis can be referred to as a laboratory technique for separating DNA, RNA, as well as…
Q: Rh factor is a protein that can be found on the surface of red blood cells. If your phenotype is Rh+…
A: IARh+ IARh+ IARh- IARh- IB Rh- IAIBRh+ (AB+) IAIBRh+(AB+) IAIB Rh- (AB-) IAIB Rh-(AB-) i Rh-…
Q: Which one of the following puts extravasation (diapedesis) stages in order from beginning to end?…
A: When a body gets infected through pathogens, a multistep process starts. This process of immune…
Q: If Lamarck and Darwin had debated why giraffes have such long necks, how would their explanations…
A: Evolution is a steady ( gradual) phenomenon which cause transformation of life from simple to…
Q: Descrive the difference between a missense mutation and a nonsense mutation?
A: The mutation is the change in the DNA sequence that can be responsible for changing in the amino…
Q: Turtles, lizards, and birds belong to one major lineage of amniotes, and_______ belong to another.…
A: Introduction:- Amniotes are vertebrates that grow their embryos in a sac called an amnion. A…
Q: Give the names and the role of inhibitors of replication.
A: DNA replication It is a biological process that occurs in all living organisms and copies their…
Q: Which of the following is a FALSE statement regarding human chromosomes? A. The chromosome…
A: Introduction :- Chromosomes are threadlike structures made up of protein and a single molecule of…
Q: What are some treatments and cures for west nile virus? What is the current research for the west…
A: Answer
Q: Which is NOT a characteristic of mitochondria? They: A) have two membranes. B) are the site of…
A: Organelles are the specialized structures that perform various jobs inside the cells. The term…
Q: Twenty snakes with the Aa genotype migrated to a population of 80 snakes of the same species with…
A: Hardy-Weinberg Equilibrium is a concept that researchers use to analyze gene evolution in a specific…
Q: Enzyme linked receptors: Function directly as enzymes or they are linked to enzymes O Are surface…
A: Enzymes are the biocatalyst that are responsible for enhancing the activation energy. These are…
Q: 12. hybrid purplo 13. hotorozygous purplo flowors x whito floworo flowars x wtillo lowors PP PA AP…
A: The Punnett square is a method for predicting the outcomes of genetic crosses. It was developed by…
Q: Which figure represents competitively inhibited enzyme? Substrate Substrate Substrate Enzyme…
A: Enzymes are proteinaceous molecules which when added up into the reaction , accelerates the process…
Q: Within the eukaryotic cell, the source of most of the energy stored in ATP is produced through the:…
A: Introduction - Organisms with a nucleus and other membrane-bound organelles are known as eukaryotes.…
Q: O Isotonic solutions. Pepsin enzyme becomes denatura Owhen pH is acidic O Temperature is very high O…
A: Temperature is very High.
Q: Transcribe and translate the RNA. AUG GAG CAU CCU UGG GCA GCC UUA
A: Transcription and translation Transcription is the process when the DNA is converted into RNA. and…
Q: Imagine you are a conservation biologist and are called upon to design a preserve with maximum…
A: Introduction Biodiversity provides many services and goods, such as fuel, food, materials, clean…
Q: Please answer the following statements with true or false True False Peripheral proteins interact…
A:
Q: А D
A: Bones joins to form skeleton of body. Bones made from osteocytes cells, calcium & phosphates.
Q: A G-protein is active when: OIt is phosphorylated by protein kinase O Ca2+ is bound to it OGTP is…
A: G proteins are a group of proteins that operate as molecular switching devices within the cells,…
Q: In the US, many farmers regularly use the herbicide glyphosate to keep their fields free from weeds.…
A: Natural selection is proposed by Charles Darwin. The main concept here is the process through which…
Q: Mention the name of the hormone which inhibits the release of growth hormone from the Pituitary…
A: Introduction - The pituitary gland is a tiny gland located beneath the brain and beyond the bridge…
Q: What organs can you donate while alive?
A: Organ donation takes healthy organs and tissues from one person for transplantation into another. It…
Q: A plant cell placed in a hypertonic solution will: O remain unchanged. O swell slightly. O undergo…
A: The three types of solutions that cause water to move in and out of the cell are- Hypotonic,…
Q: which of the following is most directly involved in the process of autophagy?
A: Answer
Q: Describe the mode of entry and method of reproduction of each representative trematodes…
A: * Schistosoma japonicum male worms are yellow in colour which measures about 12mm by 0.5mm with…
Q: Why are mRNA vaccines more effective than conventional vaccines?
A: Introduction :- A vaccine is a preparation that stimulates the body's immunological response to…
Q: Which figure represent the lock and key model? Substrate Figure 1 Figure 1 Figure 2 Figure 3 Enzyme…
A: Introduction : lock and key model denoted the enzyme substrate interaction . Each Enzyme has a…
Q: entities that sustain parts of plant and plant sap. bio question pls answer asap
A: Prokaryotic cells lack a membrane-bound nucleus and other cell organelles (membrane-bound). Their…
Q: How can one cell give rise to different types of cells? Support your explanation with embryologic…
A: In embryological evidence , all sexually reproducing organisms start their lives from a single cell,…
Q: Unlike Archaeopteryx, modern birds have_______ . a. a long bony tail c. a two-chambered heart b. a…
A: The oldest known fossil bird is Archaeopteryx, which dates from the late Jurassic period. It…
Q: What is the average level of daily nutrient intake to meet the requirement for 1/2 of healthy…
A: Nutrition- This is a biochemical and psychological process by which organisms uses food to support…
Q: When changing your diet it’s important to know how cells in your body will react to the introduction…
A: We are what we eat is a simple yet very important concept in the field of science. Whatever we eat…
Q: If we started an orthodromic action potential at the axon hillock and an antidromic action potential…
A: * Two types of directions can be seen in electrical stimulus . They are orthodromic direction…
Q: Label the part of the male and female picture below:
A:
Q: 8. Place a letter in the appropriate blank below. Conservation Biology Protected habitats Benefits…
A: According to Chapman and Reiss "Management of Earth's resource in a way which restores and maintain…
Q: In some wasps, the workers are more related to the sons produced by workers than to the sons…
A: * wasp colonies made from chewed wood and saliva which can be found hanging on trees or leaves.…
Q: A principle of biology is that biology affects our society. What is the value of increased…
A: INTRODUCTION Biodiversity, also known as biological diversity, refers to the variety of life present…
Q: E7 A Moving to the next question prevents changes to this answer. Question 1 What are the two phyla…
A: Helminths are invertebrates, large macroparasites general term meaning worm. Some of helminths are…
Q: Figure 1 Figure 2
A: DNA is known as the deoxyribonucleic acid. DNA has the chromosome which carries the genes and these…
Q: The primary structure of a protein is formed in the A) the RER, B) Golgi apparatus, C) nucleoid, D)…
A: Protein is a polymer of amino acids. The peptide bond is present between two amino acids.
Q: Here is a karyotype made from cancer cells. Which of the following abnormalities can be detected?…
A: * Translocation is change in location it occurs when part of chromosome is transferred to another…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNAI’m supposed to translate tRNA into amino acids for each codon of the previous question and state what the amino acid chains become. For example: AUG AAA CGC CCA....Write the CODON that corresponds with each amino acid. There may be more than one. The full names are written, but the codon chart only shows the first three letters. glycine ______________________ phenylalanine ______________________ arginine ______________________
- Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop sequences. UGCGAUGGCAAUCGGUGUACCCCUGACUGAGCUsing the codon chart, if the DNA strand being described is AGG TCT GAT , the resulting amino acid would be whatFrom the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.
- Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC GCG CGG UAA-3'Identify the middle, end and beginning sequence. Use your knowledge of start and stop codons to figure it out. Remove codons 24 to 66, including codon 66.What is the complementary sequence of the given nucleic acid sequence? (Write your answer in the 5'-->3' direction) Given: ACTGGTCAGGCTTACGTAGTC
- if the DNA sequence if: TTACGTA, the complementary RNA sequence will be following A. AATCGAT B. AATGCTA C.AATGCAT D.AAUGCAULook at Table 26.3 and find codons for the following amino acids:(a) Val (b) Arg (c) SerState if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3' Translate the sequence (codon chart included) +1 TAGTCCAAAGGTTTACGTAAATGGGATGTCGAAATTGACTAGATCA