at a certain school, student email addresses end with @student.college.edu, while professor email addresses end with @prof.college.edu. write a program in python that first asks the user how many email addresses they will be entering, and then has the user ener those addresses. after all the program should print out a message indicating either that all the addresses are student addresses or that there were some professor addresses entered
Q: Write a program that reads two pieces of information: the hourly wages and the number of hours…
A: step 1: ask for employee hourly wages step 2: ask for the number of hours worked step 3: calculate…
Q: Write a program that computes the molecular weight of a carbohydrate (ingrams per mole) based on the…
A: Given: Write a program that computes the molecular weight of a carbohydrate (ingrams per mole) based…
Q: As a Python programmer in one company/institution, you are task to create a program that converts…
A: In this user has to input choice whether user wants to convert Celsius to Fahrenheit or Fahrenheit…
Q: In this week's task you have to develop a python code that find out if it's possible to find out, if…
A: As per the given problem statement we have to develop a python code that find out if it’s possible…
Q: Write a C Program that allows a user to enter any number of student test scores until the user…
A: Program: TestScoreStatistics.h #ifndef TestScoreStatistics_H #define TestScoreStatistics_H…
Q: I need this in python Write a program that prints a formatted "No parking" sign as shown below.…
A: Your python program is given below as you required with an output.
Q: Write a program that reads two pieces of information: the hourly wages and the number of hours…
A: Required: Write a python program to calculate the net salary based on given instructions. all the…
Q: Imagine that you run a local store that has an electronic pad located at the exit of the store that…
A: Below is a required program in python: Program Approach: Display a message to the user to enter…
Q: Write a Python script that converts a positive integer (must be less than 4,000) into the Roman…
A: q: Write a Python script that converts a positive integer (must be less than 4,000)into the Roman…
Q: Write a Python program to accept student ID, student name, marks in two quizzes (each quiz out of…
A: Program Approach: Create 2 empty lists q_marks and a_marks for storing the marks obtained by a…
Q: Write a python program that asks the user to enter exam scores, the number is based on what the user…
A: def input_function(n, scores): print("Enter the score(s):") for i in range(n):…
Q: Write a program in python that reports the contents of a compressed-gas cylinder based on the first…
A: color_code = input("Enter a character, representing the color of the cylinder: ") # taking…
Q: Write a complete program that: 1. Prompts the user to enter an integer and reads in an integer…
A: CODE:- #include <iostream>using namespace std;int main(){ int f, s, sum , sub , divi ,…
Q: An online store wants to give prizes to their loyal customers. Write a python program that reads the…
A: Program Description: An online store wants to give prizes to its loyal customers. Write a python…
Q: student enters the number of college credits
A:
Q: In a library catalog, the followings are stored about each book: the author and the title, available…
A: Sol: Algorithms Step1: First of all we have taken input n for count the book Step2 then we have…
Q: write a python program to Create a variable containing the DNA sequence: ACGCAGAATGCTTAGGACTAGTTAC…
A: Start Declare a variable dna and initialize value Replace T with U and store it as rna Print middle…
Q: In this exercise you will create a program that reads a letter of the alphabet from the user. If the…
A: In this program Get the input alphabetical letter from the user Using if statement check the entered…
Q: Many user-created passwords are simple and easy to guess. Using java language, write a program that…
A: The string will be taken by the user using Scanner class or BufferedReader Class. The taken string…
Q: write a PYTHON program for An online music and apps store offers all apps for 3$ each and all songs…
A: Program for the above describe condition: app = 3 song = 7 prepay = int(input('How much money do you…
Q: Write a program that reads from the user a number that represents its grade, and then displays a…
A: As no programming language is mentioned, it is solved using basic C++
Q: Write a program that reads two excel sheets. One of these sheets contains a list of items names. The…
A: CODE: # Import library to read excel fileimport openpyxl # Reading the sheets in the…
Q: Imagine that you run a local store that has an electronic pad located at the exit of the store that…
A: Below is the required python program: - Approach: - Prompts the user to enter the positive clicks…
Q: In Python write a program that demonstrates the scenario below: An employee’s total weekly pay…
A: We need to provide a python program to employee’s total weekly pay. Where, total week pay= regular…
Q: Write a program to convert a measurement given in feet to the equivalent number of (a) yards, (b)…
A: Program requirements: The c++ program prompts the user to enter the value for feet and then…
Q: In Python: The line endings are missing. Usually a gift line ends with a comma (","), but the last…
A: Task : Given the python code. The task is to modify the code so that given + and , can be added to…
Q: Write a program that consists of the code below. a = 1 b = "One" c = 5.2 d = "5.2" e = "3" aa =…
A: Objective: According to the question, we need to rectify some errors and state the reasons for…
Q: Write a program that prompts the user to input a number. The program should then output the number…
A: According to bartleby guidelines we need to answer only the first question. Algorithm: 1.import…
Q: Write a program that converts U.S. dollars toCanadian dollars, German marks, and British pounds, as…
A: Program: import java.text.NumberFormat; import java.util.Locale; import…
Q: Write a program that performs the following: 1) request a full name input by the user 2) display the…
A: Please see the next step for the program.
Q: Write a complete Python program that prompts the user for his/her first name and last name, and with…
A: def main(): welcomeString="Welcome "; #initialize welcomeString as Welcome and a space…
Q: In a retail store, they offer an anniversary sale for their specially designed T-shirts (A, B, and…
A: Hi. Let's move on to the code in the next step. I have included comments in the code that will…
Q: Write a program that asks the user to enter a password consisting of 7 characters. If the user…
A: Program: //import the header file import java.util.*; //definition of class class Main {…
Q: Write a python that calculates the position of a car moving in a 2D-plane given the list of…
A: To write the python program with the given description: Use a while loop, that will prompt the user…
Q: In Python Write a program that computes the fuel efficiency for a multi-leg journey. The program…
A: def main(): #Prompt the user to enter the input. start_odo = float(input("Enter the initial…
Q: Write a program for the Animal Express delivery company. The company charges by the kilogram for…
A: The python code is shown in the following steps.
Q: Write a Python program that asks a user for their name, age and password. If their age is less than…
A: Solution: Given,
Q: Write a program that calculates and prints the bill for a cellular telephone company. The company…
A: C++ Code: #include <iostream>#include <iomanip> using namespace std;int main(){ int…
Q: Consider the following C++ code. string str1, str2;char ch;int pos;cin >> str1 >> str2…
A: The given code takes two strings as user input. The user also asks the user to give the index of the…
Q: Write a program that begins by reading a temperature from the user in degrees Celsius. Then your…
A: Given: To Write a program that begins by reading a temperature from the user in degrees Celsius.…
Q: In C++ language, create a program that gets quarterly sales from a user, and calculates the total of…
A: - We need to code for the sales program.
Q: Python write a program that allows the store to enter the total positive clicks and the total…
A: Python code for: Here you need to take 2 inputs from the user and then do subtraction to get the…
Q: At a certain school, student email addresses end with @student.college.edu, while professor email…
A: Lets see the solution.
Q: Write a program that takes in the user’s name and age. Then displays his/her name’s initial letter…
A: Algorithm: Start Var name, age Accept name from user Accept age from user Display(name[0]) Display…
Q: Q4: Write a FORTRAN90 program that reads a student ID and his GPA out of 4.0. The program should…
A: Algorithm: Start Read student ID and GPA If gpa>=3.5 then print "EXCELLENT" Else if gpa<3.5…
Q: Write a python program that: 1. Asks the user to enter the salary of 15 employees, 2. Count and…
A: Step-1: Start Step-2: Declare a list salaryList Step-3: declare count =0 Step-4: Start a for loop…
Q: Write a program that mimics a calculator. The program should take as input two integers and the…
A: #include <iostream>#include <iomanip>using namespace std;int main(){char op;int…
Q: Write a Python program stored in a file q1.py that calculates what day of the week a certain date…
A: PROGRAM EXPLANATION: - Two string[]s are declared and initialized with string values. full_days…
Q: Write a program that ask the user to enter his/her letter grade and then respond with an appropriate…
A: grade = input("Enter your grade : ") #taking user inputif(grade == 'a' or grade == 'A'):…
' at a certain school, student email addresses end with @student.college.edu, while professor email addresses end with @prof.college.edu. write a
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 2 images
- In Python, A sales event at Trader Jane's is reducing some items by 25%. Store that value to a properly named constant. Write a program that functions like a cashier terminal for one item. Some items are subject to 7% sales tax and some are not. Use a constant for the sales tax value, too. Write a program for Trader Jane's that runs as shown next: Enter the ticket price of the item 100 Is this item reduced y/n? y is this item taxable y/n? y Here is your bill Original price $100 Reduction during event $25.00 Final price $75.00 7% Sales tax $5.25 Total amount due $80.25 Plan each program by writing pseudocode. Write all of your pseudocode as comments immediately after your name and SPC ID#. Add more comments as needed in each program to explain your code. Choose descriptive variable names in all programs. Currency format. There should be no space between the $ sign and the first digit. See sep on page 66 to cancel the space automatically added when print items are separated by…Write a program that reads the user's first name and last name, and then use them to create a UPM email for the user. If the total number of characters in the user's full name, (first name + last name), is less than 10 letters, you should use the full name to create the user’s email. The general format of the user’s email should look like this: firstName.lastName@upm.edu.sa For example: First name = Ali Last name = Omar Total number of letters in both first and last names = 7 letters (<10 letters) Output = omar.ali@upm.edu.sa If the number of characters in the user's full name, (first name + last name), is greater than or equal to 10 letters, you should only use the first character in the user’s first name, and the whole last name to create an email. For example: First name = Abdullah Last name = Omar Total number of letters in both first and last names = 12 letters (>=10 letters) Output = a.omar@upm.edu.sa Note: you can assume the user will always enter lowercase lettersThis is for Python Write a program that takes a first name as the input, and outputs a welcome message to that name. Ex: If the input is Pat, the output is: Hello Pat and welcome to CS Online!
- Solve in Python: Write a program that creates a login name for a user, given the user's first name, last name, and a four-digit integer as input. Output the login name, which is made up of the first five letters of the last name, followed by the first letter of the first name, and then the last two digits of the number (use the % operator). If the last name has less than five letters, then use all letters of the last name. Ex: If the input is: Michael Jordan 1991 the output is: Your login name: JordaM91 Ex: If the input is: Kanye West 2024 the output is: Your login name: WestK24Write a program that asks users when their birthday is. Use information provided to give them their astrological sign. Each of the twelve signs should display a different horoscope. Use the following dates for each sign, keeping in mind that both month and day must be evaluated for an accurate result. Aries: March 21–April 20 Taurus: April 21–May 21 Gemini: May 22–June 21 Cancer: June 22–July 22 Leo: July 23–August 22 Virgo: August 23–September 23 Libra: September 24–October 23 Scorpio: October 24–November 22 Sagittarius: November 23–December 21 Capricorn: December 22–January 20 Aquarius: January 21–February 19 Pisces: February 20–March 20Write a program for a Bookstore to take an order from a customer, calculate how much to charge a customer based on his/her order, and display a receipt. The store sells only three books, designated by their authors: Cervantes ($41.25 each), Homer ($15.85 each), and Shakespeare ($30.50 each). Your program is to work as follows: Display a welcome message (e.g., “Welcome to the Bookstore!”) Prompt the user for his/her first name Prompt the user to input the number of books by Cervantes s/he wants Prompt the user to input the number of books by Homer s/he wants Prompt the user to input the number of books by Shakespeare s/he wants Compute the total amount due, including a 10% sales tax Display amount due Ask the user how much money s/he will pay Display a receipt listing the name of the user, the quantity of each item ordered, the total cost of the order, and the amount the user will have left after paying Execution of the compiled program should appear roughly as follows (with red…
- "Write a python code that asks the user to enter several numbers that are a multiple of 5. If the user enter a value that is not a multile of 5 it should prints a message and prompt for the user to enter a new number. The user can stop the process by inputing the string *done*. At the end print the total number of values entered that are a multiple of 5. "Using Java.. Write a program that reads the user's first name and last name, and then use them to create a UPM email for the user. If the total number of characters in the user's full name, (first name + last name), is less than 10 letters, you should use the full name to create the user’s email. The general format of the user’s email should look like this: firstName.lastName@upm.edu.sa For example: First name = Ali Last name = Omar Total number of letters in both first and last names = 7 letters (<10 letters) Output = omar.ali@upm.edu.sa If the number of characters in the user's full name, (first name + last name), is greater than or equal to 10 letters, you should only use the first character in the user’s first name, and the whole last name to create an email. For example: First name = Abdullah Last name = Omar Total number of letters in both first and last names = 12 letters (>=10 letters) Output = a.omar@upm.edu.sa Note: you can assume the user will always enter lowercase…Write a program which defines three integer variables, var1, var2 and var3, & initializing them to the values 100, 200 & 300, it then prints out their addresses. Subject : C++
- Write a python program that asks the user to enter exam scores, the number is based on what the user wants to enter. The program will display a letter grade and associated message for each score, based on the table below, and the average exam score. The program will not contain any repeated code and have a minimum of two functions besides Main. Score Letter Grade Message 90 – 100 A Excellent work 89 – 80 B Nice job 79 – 70 C Not bad 69 – 60 D Room for improvement Below 60 F Go back and reviewIn python please provide the code On a piano, a key has a frequency, say f0. Each higher key (black or white) has a frequency of f0 * rn, where n is the distance (number of keys) from that key, and r is 2(1/12). Given an initial key frequency, output that frequency and the next 4 higher key frequencies. Output each floating-point value with two digits after the decimal point, which can be achieved as follows:print(f'{your_value1:.2f} {your_value2:.2f} {your_value3:.2f} {your_value4:.2f} {your_value5:.2f}') Ex: If the input is: 440 the output is: 440.00 466.16 493.88 523.25 554.37Write a program that prompts the user for a U.S. dollar amount and then converts it to Japanese Yen, British Pound, and New Zealand currency. Once you calculate the conversion, print a single line with each converted currency only showing two decimal places, and its respective code (as shown in the example below): 10 U.S. Dollars in Egyptian Pound (exchange rate = 15.9976) would print as follows after conversion: 10.00 USD in Egyptian Pound is 159.98 EGP