atch the substance to It's function. v Prevents supercoiling/Overwinding of the DNA A. Nucleosomes v Unwinds and separates the double stranded DNA B. Toposiomerase v Adds a short piece of complementary RNA nucleotides C. Ribosome v Copies DNA and adds complimentary DNA nucleotides D. Nuclease v Prevents DNA strands from connecting E. RNA polymerase v Links together short segments of DNA F. Helicase v Found only in the lagging strand G. DNA Polymerase v What chromosomes are made of H. DNA and Proteins v The proteins found in chromosomes I. Codon

atch the substance to It's function. v Prevents supercoiling/Overwinding of the DNA A. Nucleosomes v Unwinds and separates the double stranded DNA B. Toposiomerase v Adds a short piece of complementary RNA nucleotides C. Ribosome v Copies DNA and adds complimentary DNA nucleotides D. Nuclease v Prevents DNA strands from connecting E. RNA polymerase v Links together short segments of DNA F. Helicase v Found only in the lagging strand G. DNA Polymerase v What chromosomes are made of H. DNA and Proteins v The proteins found in chromosomes I. Codon

Name: Match the substance to it's function.v Prevents supercoiling/Overwind
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Match the substance to it's function.v Prevents supercoiling/Overwinding of the DNAA. Nucleosomesv Unwinds and separates the double stranded DNAB. Toposiomerasev Adds a short piece of complementary RNA nucleotidesC. Ribosomev Copies DNA and adds com

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 15SA: Match the terms appropriately. ___ nucleotide ___ clone a. nitrogen-containing base, sugar,...

See similar textbooks

Similar questions

Match the terms appropriately. ___ nucleotide ___ clone a. nitrogen-containing base, sugar, phosphate groups ___ autosome b. copy of an organism ___ DNA polymerase c. does not determine sex ___ mutation d. injects DNA ___ bacteriophage e. replication enzyme ___ semiconservative replication f. can cause cancer g. something old, something new ___ DNA ligase h. seals gaps and breaks
A student mixes various molecule needed for DNA replication. When he adds DNA, replication occurs, but each DNA duplex consists of a normal DNA strand paired with numerous segments of DNA a few hundred nucleotides long. What has been left out of the mixture? A. NTPs B. DNA polymerase III C. ATP D. DNA polymerase I E. DNA ligase
Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made
Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?
You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’
Which of the following is NOT true of DNA polymerase? a. DNA polymerase builds the new strand from 5' to 3'. b. DNA polymerase can start new DNA strands independently. c. DNA polymerase uses a "guess and check" method to add nucleotides. d. DNA polymerase uses dATP as a nucleotide. e. DNA polymerase reads the template from 3' to 5'.
During DNA replication, a template strand is used to synthesize a new "daughter" strand of DNA. Below is a sequence of a short segment of DNA. Provide the base sequence in the complementary strand and label all ends. 5’ A A T C G T A A G C T 3’
A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
Number the steps of DNA replication in the correct order (1, 2, 3) a) ______ Polymerase travels down the DNA parent strand b)______ DNA strands are unzipped c) ______ Ligase binds Okazaki fragments together
The DNA nucleotide sequence that's complementary will base pair to a strand of DNA with the following sequence, 5' GTAATC 3' is? 5'GUAAUC3' 3'CATTAG5' 5'CATTAG3' 3'CAUUAG5' 3'GTAATC5'
Which would need to occur to replicate DNA? (select all that apply) Group of answer choices the parental strand is used as a template DNA polymerase binds to a promoter and moves down the DNA adenine pairs with thymine the DNA coils tightly to form the replication fork adenine pairs with guanine hydrogen bonds are broken
View the given linked video to see the detailed structure of the different kinds of DNA. After analyzing make a simple illustration to relate the different kinds of DNA to its function. https://www.youtube.com/watch?v=o_-6JXLYS-k