3. Consider the following diagrams representing three different DNA molecules. (a) 5' w 3' 3' 5' (b) 5' 3' 5' 3' (c) 3' 5' Assuming that DNA polymerase is the only enzyme present and that there is no additional DNA, state whether each of these molecules can serve as a substrate for DNA synthesis. Give reasons as to why or why not.

3. Consider the following diagrams representing three different DNA molecules. (a) 5' w 3' 3' 5' (b) 5' 3' 5' 3' (c) 3' 5' Assuming that DNA polymerase is the only enzyme present and that there is no additional DNA, state whether each of these molecules can serve as a substrate for DNA synthesis. Give reasons as to why or why not.

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 9SQ: Which of the following is/are not required for DNA replication to occur? a. DNA polymerase b....

See similar textbooks

Similar questions

1. discuss the effect of temperature on the viscosity of the liquid 2. DNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?
3,Compare the free energy, ∆G, of A-T binding and A-C binding, which one is more negative? Does this makes sense in terms of the structure of DNA? Group of answer choices A, ∆G of the A-T binding is more negative than that of the A-C binding, which is consistent with the fact that A-C binding is not favored in DNA helix. B, ∆G of the A-T binding is more negative than that of the A-C binding, which is consistent with the fact that A-C binding is favored in DNA helix. C, ∆G of the A-C binding is more negative than that of the A-T binding, which is consistent with the fact that A-C binding is not favored in DNA helix. D, ∆G of the A-C binding is more negative than that of the A-T binding, which is consistent with the fact that A-C binding is favored over A-T binding in DNA helix.
5) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differences between the reaction catalyzed by the polymerase activity of a DNA polymerase and the reaction catalyzed by ligase.
8. What is happening to the DNA molecule in the figure? Also, discuss the types and functions of enzyme participating in this step.
1. UV light damages DNA by the formation of pyrimidine dimers. Draw the detailed chemical structure of a pyrimidine dimer and explain why the formation of such aberrant structures results in tumor-enabling genomic instability. 2. Use your own words to define ultraviolet light. Include a comparison of naturally-occurring vs artificial UV. What is UV-A? UV-B? UV-C? Which one(s) is (are) the most damaging to DNA? Why? Which one(s) are most likely to lead to a mutation in skin cells? Why? What type of UV light is used in tanning beds?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1. Using the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing cut fragments would appear. The linear uncut DNA is 640 base pairs in length. Insert an image below.
1. DNA plays an important role in two processes. During the process of replication, dna provides information to copy itself, so genetic information can be passed on from one generation of cells to the next. DNA also provides instructions for making proteins, in these instructions are vital to the maintenance and function of cells. DNA provides the information on how to order the amino acids required for making various proteins. Describe the significance of crude extraction of DNA from different sample organismic. 2. Distinguish the importance of the following theorems that are interrelated to the study of bioinformatics: (1) proteomics, (2) genomics, (3) biotechnology, (4) biostatistics, and (5) biological engineering. 3. Describe the procedures that you have encountered in the bacterial identification virtual laboratory (media.hhmi.org). Describe each part of the procedure: (1) simple preparation, (2) PCR amplification, (3) PCR purification, (4) sequencing preparation, (5) DNA…
1. Consider the following DNA segment: 5’….ATGCCCGATCAGAGCTTT…3” 3’….TAGGGGCTAGTCTCGAAA…5’ A. How many Phosphodiester bonds are required to form this segment of double-stranded DNA? B. How many hydrogen bonds are present in this DNA segment?
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
5. The DNA sample in your final vial contains numerous strands of DNA ( 46 chromosomes from EACH cell lysed; and we hope hundreds of cells were lysed). Despite having all of this DNA present in your vial with the Master Mix, only one specific portion of your DNA will be amplified ; which part? How are we able to locate and copy just this region instead of accidentally copying other regions of DNA ?
1. Describe what you saw on the boundary between the fruit mixture and the alcohol. 2. Based from our previous lessons, draw the a.) chemical and b.) double-helix structure of DNA. Label the DNA components. 3. Why do you think there is a need to mash and strain the fruit to isolate the DNA? 5. Identify the complementary nucleotides for the DNA chain below: 5’ GCATTTAAATTGGGGCGCGTAATGCCGGGGGATTACCCAATATGTAC 3