a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG. TGACCATGAAACTCACACCGGGGCGCACTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: TAGTGGTACGGCC b. Using this DNA double helix, express the gene - i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. When you type in the answer Do NOT put spaces between the amino acids - e.g. MetThrLys... When you get to a stop codon - you may type in an asterisk - **u polypeptide sequence: AUCACC met, pro,: c. Does the sense strand DNA sequence have 5' and 3' UTR sequences? If so - write them in the space below using CAPS LOCK and NO SPACES - e.g. ATGCCGAG. 5'UTR = AUCACC 3'UTR = UAUAACACAUUU UUU UUC UUA UCU UCC UCA UCG UAU UAC UAA UAG UGUT UGC UGA Phe Tyr Cys Ser Stop Leu UUG Stop UGG Trp CU CUU CUC CUA CUG CGU Y CGC CGA CGG CAUY His CAC Leu Pro Arg CA CcG) CAA Gin CAG} AGU AUU AUC AUA AUG ACU ACC ACA ACG AAU AAC AAA Asn Ser AGC J AGA Arg AGG le Thr Met AAG Lys GGU GGC GUU GUC GUA GUG. GCU GCC GCA GCG GAU Asp GAC GAA Glu Val Ala Gly GGA GGG , GAG

a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG. TGACCATGAAACTCACACCGGGGCGCACTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: TAGTGGTACGGCC b. Using this DNA double helix, express the gene - i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. When you type in the answer Do NOT put spaces between the amino acids - e.g. MetThrLys... When you get to a stop codon - you may type in an asterisk - **u polypeptide sequence: AUCACC met, pro,: c. Does the sense strand DNA sequence have 5' and 3' UTR sequences? If so - write them in the space below using CAPS LOCK and NO SPACES - e.g. ATGCCGAG. 5'UTR = AUCACC 3'UTR = UAUAACACAUUU UUU UUC UUA UCU UCC UCA UCG UAU UAC UAA UAG UGUT UGC UGA Phe Tyr Cys Ser Stop Leu UUG Stop UGG Trp CU CUU CUC CUA CUG CGU Y CGC CGA CGG CAUY His CAC Leu Pro Arg CA CcG) CAA Gin CAG} AGU AUU AUC AUA AUG ACU ACC ACA ACG AAU AAC AAA Asn Ser AGC J AGA Arg AGG le Thr Met AAG Lys GGU GGC GUU GUC GUA GUG. GCU GCC GCA GCG GAU Asp GAC GAA Glu Val Ala Gly GGA GGG , GAG

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 22P

See similar textbooks

Similar questions

a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
Give typing answer with explanation and conclusion 5'ATTAGGAGGTGCGTTATGCAGGCATGTTACGTACGTACG,TAAGATAAGTACT3’ 3' TAATCCTCCACGCAATACGTCCGTACAATGCATGCATGCATTCTATTCATGA5’ In the above piece of double stranded DNA, how many potential translations start sites exist if an mRNA could be synthesized from any portion of this DNA? Indicate where they are in the DNA above and explain how you found this number.
Remember when looking up a codon make sure it is in its mRNA form. Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age. What problem does this create? 3.What are three differences between a point mutation and deletion mutation
A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
Describe the d=features of the following DNA-binding domains and how they interact with DNA. Helix-turn-Helix Zinc Finger Leucine Zipper Helix-loop-Helix
a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?
The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG