AUUAGC is the MRNA of a virus. Answer the questions below: a. What is the genome if the above virus is 1. HIV? AUUAGC [ Select ] AUUAGC 2. an Influenza virus v UAAUCG TAATCG ATTAGC
Q: What is the course of vaccination for babies in the first two years after birth?
A: Vaccination Vaccination is a simple way to protect people from harmful diseases.
Q: Match each protist with its most suitable description. ____ diplomonad a. whirling cell…
A: A protist is any eukaryotic life form that is not an animal, plant, or fungus. While almost…
Q: Synthesis: How does reproductive isolation differ in sympatric modes and allopatric modes of…
A: The reproductive isolation leads to the speciation that results in development of new species from…
Q: The separation of homologous chromosomes in meiosis occurs in what phase?
A: ANSWER) Anaphase 1
Q: Define decellularization.
A: Dear student as per Bartleby policy i can solve only first part of the question. It is asking about…
Q: what present microorganisms in flipper spoilage and springer spoilage
A: Spoilage of food is often observed in canned food items. There are roughly four types of bulged or…
Q: In tumor cells Rb protein is hyperphosphorylated. In response to that, will p53 level increase or…
A: Rb protein is a very powerful tumor suppressor protein it checks the cell cycle and when it's levels…
Q: heart
A:
Q: a population of beans that is mostly diploid, there are an assortment of them: black, white, orange,…
A: Number of Alleles in a population can help us determine the genotype of the individual and also…
Q: Explain with suitable examples the different types of phyllotaxy?
A: When it comes to plants, the pattern or arrangement of leaves on the stem or branch is referred to…
Q: 2. How is RNA termination different in prokaryotes vs eukaryotes? Include an explanation of cis vs.…
A: The process of creating a copy of RNA (ribonucleic acid) of a gene sequence can be referred to as…
Q: Describe modifications of stem with suitable examples
A: It has been discovered that the stems of various plants have been modified to perform different…
Q: Complete the following paragraph by filling in the blanks (i) to (v) with appropriate words: To test…
A: Intro - the question is related to plant anatomy and we need to fill ups the correct option in it.…
Q: The concept that an enzyme will turn on when its active site joins in a "perfect fit" with a…
A: Introduction - Enzymes are globular proteins that aid in the catalysis of metabolic processes. Each…
Q: If antibody RH is given to a person with a B+ blood type what would happen? If antibody RH is given…
A: *Blood group A will contains Antigen A on RBC and antibody B on plasma *Blood group B will contains…
Q: 2. Identify the kind of chromosome error in each diagram. Chromosomal Error X X Y TIID ×
A: Chromosomal errors result in various kinds of diseases which are incurable and decrease the life…
Q: Compared to a somatic cell in Go, a germ cell at telophase of meiosis I has amount of DNA and number…
A: Somatic cells are cells other than germ cells of the body. They have diploid or 46 chromosomes in…
Q: Identify the variation of gametes from the genotype Bb Ll?
A: Gametes are the haploid cells. They are produced by the process of meiosis.
Q: The genotype of a green pea is unknown. It is crossed with a recessive yellow pea. The results are…
A: A test cross is an experimental cross of an individual organism of dominant phenotype but unknown…
Q: Select examples of health risks of excessive body fat Select 4 correct answer(s) Asthma…
A: OBESITY is defined as excessive accumulation of body fat ( adipose tissue) that is of sufficient…
Q: ACA www GAC GGG TTA CC AAG GTT TAG ATC ТАС Coding strand-DNA Template strand-DNA MRNA-codons…
A: * DNA consists of four nucleotides They are Adenine Guanine Thymine Cytosine *RNA consists of…
Q: What is the Leaf Economic Spectrum in different taxa?
A: In biology, taxa can be defined as a group of on or more populations of an organism. This represents…
Q: An example of Negative Feedback Loop could be: A. Hormones released when giving birth B.…
A: The feedback mechanism is the physiological regulatory system in the living body that works to…
Q: Proapoptotic proteins ---- cytochrome c in the cytosol. release prevent the release of #4) Humans…
A: Cancer It is the uncontrolled growth of cell which can harm the organism and causes serious health…
Q: 6. Identify the mode of inheritance for the following pedigree. Provide the genotypes of indicated…
A: Inheritance patterns are the ways through which genetic traits are passed on to the next…
Q: (ii) Which one of the following is non- biodegradable?
A:
Q: If you are experimenting on a haploid cell with DNA that is equal to 5. What is the amount of DNA…
A: * cell cycle have the following stages G1 phase S phase G2 phase Mitotic phase * During G1…
Q: Describe the identifying features of Anthozoa, Cubozoa, Hydrozoa and Scyphozoa. (These are the major…
A: Introduction cnidarian, also called coelenterate, is a phylum under the kingdom Animalia containing…
Q: characteristics of gymnosperms
A: Gymnosperm : The term gymnosperm is derived from gymno ( which means without cover ) and sperma (…
Q: #6) Histological work suggests that colon cancer develops in a multistep fashion. Which of the…
A: ANSWER) (5) a, b and c Colonoscopy is the medical procedure for detecting the abnormal changes in…
Q: Electron transport is coupled to oxidative phosphorylation in that it creates the proton gradient…
A: The electron transport chain and oxidative phosphorylation are the last step of cellular respiration…
Q: What is nature inspired carbon materials? Describe the synthesis of corn-cob derived carbon from the…
A: * polluted carbon emissions can converted into green fuels without any wasted energy. *Methods for…
Q: Corneal ulcer ALWAYS cause HIGH IOP .A true .B false
A: Corneal Ulcer is also known as Keratitis. It is a medical condition where an open sore occurs in the…
Q: If someone is showing symptoms of acute mountain sickness, you should Increase aerobic…
A: If someone, has fall in acute mountain sickness, he should move to a lower elevation as quickly and…
Q: What are the importance of a biodiverse ecosystem of birds in a mountain influence other organisms…
A: An ecosystem is a geographic area in which biotic living organisms interact among themselves and…
Q: Starting with the heart at the top, place the following in order as blood flows through the body.…
A: The heart is the main organ of circulatory system that pumps blood throughout the body. It helps in…
Q: Describe the identifying features of the major cnidarian classes.
A: * Cnidaria is a phylum of kingdom Animalia consists of aquatic animals in both freshwater and…
Q: The protein hormone insulin which is secreted from pancreatic beta cells undergoes folding into…
A: The protein translation occurs in the cytoplasm of the cell. The proteins are then folded into their…
Q: Sex-linked traits are those found on the sex chromosomes. Typically, recessive sex-linked traits are…
A: Sex link traits are those traits which are found on the X and Y chromosome and they are scene in…
Q: Directions: Plants have two life stages. The gametophyte life cycle, wherein a haploid spore is…
A: The gametophyte generation is short-lived in the angiosperms. The male and female gametes fuse to…
Q: How can you incorporate the concept of lifestyle change into a program for those who are in need of…
A: Maintainance of ideal body weight such as eating healthy and gradually starting an exercise plan for…
Q: What is usually the cause for the insertion of long nucleotide repeats O A hairpin that forms on the…
A: DNA polymerases are a group of enzymes that are involved in the synthesis of DNA during DNA…
Q: 2. Reproductive isolation reduces gene flow between populations. This means that each subpopulation…
A: Reproductive isolation is a strategy to prevent the production of offspring from members of…
Q: Which steps below require an ATP to run? Phosphorylation Isomerization Second Phosphorylation O…
A: * ATP also called as Adenosine triphosphate, is a molecule which carries energy in cells and it…
Q: What does the formula DPD = SF - TP mean?
A: The above mentioned question is related to cell membrane. It is asking the meaning of mentioned…
Q: Discuss three ways by which the human body is capable of utilising one single ligand in several ways…
A: A ligand is an ion or molecule that forms a coordination complex by donating two electrons to the…
Q: What is the relationship between linked genes and syntenic genes? Are syntenic genes always linked?…
A: Introduction Linkage is the phenomenon in which genes are situated on the same chromosome (linked…
Q: O Name and describe the two basic types of vaccines.
A:
Q: Give a brief explanation of the life cycle of Ascaris lumbricoides, Strongyloides stercoralis and…
A: Adult ascarids live in the small intestines. Females produce 200 000 eggs per day. Eggs are…
Q: Explain the occurrence of familial colon cancer and pediatric cancers using Knudson’s two-hit…
A: These types of cancer are very common in the world and cause high morbidity and mortality among…
Question:-
![AUUAGC is the mRNA of a virus. Answer the questions below:
a. What is the genome if the above virus is
1. HIV? AUUAGC
[ Select ]
AUUAGC
2. an Influenza virus v UAAUCG
TAATCG
ATTAGC](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F921a21fb-46c1-4cd0-8e36-b3b14c02de59%2F603c5553-1baa-40ca-a464-ff045c56b1a3%2F0gjg20b_processed.jpeg&w=3840&q=75)
Step by step
Solved in 2 steps
- explain how the virus/vaccine’s mRNA uses the cells ribosome to make a COVID capsule spikeWhich is the mRNA molecule that would be transcribed from this DNA template: TGGCAAGTACGT answer choices A.) ACCGUUCAUGCA B.) UCCGUUCUUGCU C.) ACCGTTCATGCA D.) UGGCAAGUACGUf the template strand of DNA has the sequence 5’-TCTAGGACT-3’, what will the sequence of the transcribed RNA be? A. 5’-AGAUCCUGA-3’ B. 5’-UCAGGAUCU-3’ C. 5’-AGUCCUAGA-3’ D. 5’-AGATCCTGA-3’ E. 5’-UCAGGATCT-3’
- What should be the environmental conditions for the fusion proteins of the influenza virus to show activity? Write. Based on this, what advice can you give people to protect against this virus? explainWhat would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5' ACCTCATTGCTAC 3' 3' TGGAGTAACGATG 5'What should be the environmental conditions for the fusion proteins of the influenza virus to show activity? Write. Based on this, what advice can you give people to protect against this virus? Write briefly.
- Choose the DNA sequence from which this mRNA sequence wastranscribed: 5′-AUACGAUUA-3′.a. 3′-TATGCTAAT-5′ c. 3′-UAUCGUAAU-5′b. 3′-UTUGCUTTU-5′ d. 3′-CTCAGCTTC-5′Addition or deletion of bases causes which kind of mutation? Select one: a. Frameshift mutation b. Transversion c. Transition d. TranscriptionThe DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this gene code for? The top is the coding strand. 5' GGCTATGTATAGGGTAAACTTCTGACGCCTA 3' 3’ CCGATACATATCCCATTTGAAGACTGCGGAT 5’
- after a successful infection by a viral particle, it integrates its genome into the host DNA. which term best describe the change of host genome? a. none b.silent mutation c.missense mutation d.frame shift mutationA gene includes the sequence AGAACT. When it is transcribed, what will the RNA sequence be? A. UCUUGA B. UGCCGU C. UCUUTC D. TCTTGAThere have been recent outbreaks of dog flu in the US. Why doesn't this virus infect humans? A) The virus can replicate in cells of all species but can only egress from dog cells. B) The genetic code of the virus is the same as that in dog cells but is different from other organisms. C) The virus can only attach to dog cells. D) The virus can enter cells of all species but can only replicate in dog cells.