Choose the DNA sequence from which this mRNA sequence wastranscribed: 5′-AUACGAUUA-3′.a. 3′-TATGCTAAT-5′ c. 3′-UAUCGUAAU-5′b. 3′-UTUGCUTTU-5′ d. 3′-CTCAGCTTC-5′
Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…
A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…
Q: AGGTATCGCAT is a sequence from the coding strand of a gene. What will bw the corresponding sequence…
A: The terms used in the question represents the molecules used during a gene expression. A gene is a…
Q: If a mutation deletes the start codon in a eukrayotic gene, which of the following most accurately…
A: The start codon is a three-nucleotide long sequence in a gene that is responsible for the initiation…
Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans:…
A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…
Q: List the sequences of the mRNA molecules transcribed from thefollowing template DNA sequences:a. T G…
A: The sequence of DNA that consists of genetic information is transcribed into RNA. The sequence…
Q: The function of RNA polymerase is to A) catalyze the formation of phosphodiester bonds between…
A: Gene expression is the process thorough which the DNA directs to form proteins. It involves two…
Q: Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red…
A: Red blood corpuscles (RBC) are the cells that carry oxygen thorough out the body. They are small…
Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is
A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a) 5’…
Q: Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________. a. exons…
A: The genetic material of a cell or an organism refers to those materials found in the nucleus,…
Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…
A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…
Q: Give two DIFFERENT examples of how the following can occur: a. A point mutation in an exon that is…
A: Silent mutation - Silent mutations are mutations in DNA that do not have an observable effect on the…
Q: Consider the gene that encodes telomerase RNA. Suppose that the sequence of the template strand that…
A: DNA is composed of nucleotides. There are two purine bases - -Adenosine (A), and Guanine (G), and…
Q: Which of the following best describes tRNA? a. Provides the instructions for the amino acid…
A: Translation is the process of formation of amino acids from mRNA sequence.
Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…
A: BASIC INFORMATION TRANSLATION It is the process in which protein is which formed from the…
Q: You observe a piece of mRNA. A few minutes later you see this mRNA has now been converted into DNA.…
A: mRNA is the messenger ribonucleic acid that is produced by the process of transcription. The RNA…
Q: The sequence of bases in a sample of MRNA was found to be: GGU,AAU,CCU,UU0,GUU,ACU,CAU,UGU a Deduce…
A: mRNA is messenger RNA which is produced as a result of transcription from DNA. RNA polymerase…
Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: A desired gene is defined as the insertion of copies of the gene into the living cells in order to…
Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…
A:
Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: Which is the DNA template given if the MRNA O 3- GCCTACGGGCATATGGTA -5 JACGUA -3
A: During transcription mRNA is generated from DNA by the process called transcription .and then this…
Q: Which two sequences shown in the diagram are NOT directly transcribed from the template strand of…
A: ANSWER - in this figure the following sequences are not directly transcribed from the template…
Q: Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′…
A: Ribosomes (macromolecular structure) composed of rRNA and polypeptide chains are formed of two…
Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA
A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…
Q: a. Use the parent strand as a template to synthesize mRNA strand. Describe how the mRNA strand is…
A: Gene expression refers to the process that involves the formation of a functional product of a…
Q: A scientist sequencing mRNA identifies the following strand:…
A: mRNA is termed as messenger RNA. It is a single stranded RNA used in the synthesis of protein.mRNA…
Q: Give two examples of places you could have mutations in the DNA sequence of a eukaryotic gene that…
A: The change in the heritable characteristics of the species across many generations is called…
Q: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ a.Complementary Strand: b. Direct Transcript: c. Transcript for…
A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…
Q: a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and…
A: The given DNA, 5'- ATGTCGACGCGCAGGTGA - 3' 3' - TACAGCTGCGCGTCCACT - 5'
Q: Consider the following gene with their respective introns and exons 5’ –…
A: Since you have asked multiple questions, we will solve the first three question for you. If you want…
Q: A.Give the transcript that will be formed from this template. 3- TACGGGTTATATTCAATC-5" B.Give the…
A: The DNA is copied into RNA (transcript) by a process called transcription. It takes place inside the…
Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…
A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…
Q: Refer to the following illustration to answer the question. mobile genetic elements exon 1A…
A: Transposable genetic element are the DNA sequences which can shift their original locations and…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: Since you have posted a question with multiple sub-parts, we will solve first three sub- parts for…
Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…
A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…
Q: Below is a picture of multiple mRNA molecules being transcribed simultaneously from the same…
A: mRNA transcription and translation occurs at same time in prokaryotes(polycistronic) while in…
Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…
A: Introduction According to Chargaff's rules, DNA from any cell of any organism should have a 1:1…
Q: Use the codon table shown above to help answer this question. An original (wild-type) mRNA sequence…
A: The changes in the nucleotide sequence of DNA or RNA is known as mutation that can alter the…
Q: A scientist while sequencing mrna identifies the following strand…
A: Translation is the process by which polypeptides are synthesized from a mRNA transcript which is…
Q: Finally, imagine that a mutation occurred in the codon below and an A was inserted between the two…
A: a mutation occurred in the codon below and an A was inserted between the two Ts T T G chnages to T…
Q: A gene includes the sequence AGAACT. When it is transcribed, what will the RNA sequence be? A.…
A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…
Q: Which is the mRNA molecule that would be transcribed from this DNA template:…
A: DNA is converted to RNA by the process of transcription by an enzyme known as RNA polymerase. The…
Q: _______is/are removed from a new mRNA. a. Introns c. A poly-A tail b. Exons d. Amino acids
A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and…
Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: a) Examine the nudeotide sequence below, and determine the amino acid sequence encoded by this mRNA.…
A: a) The nucleotide and translated mRNA and amino acid sequences are given below: GGA GGC CTG GCC TAC…
Q: summarize these results using concise language in a neat table; Control : 5’…
A: There are different types of mutations based on the changes in DNA sequences. It includes missense,…
Q: Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red…
A: NOTE:- As you posted multiple parts under one question, we will solve the first three for you, to…
Q: Eukaryotic mRNA is capped at the 5' end by:
A: Eukaryotic messenger RNA after synthesis in the nucleus move to the cytoplasm for translating…
Q: Which of these is the function of a poly (A) signal sequence? A. It adds the poly (A) tail to the 3'…
A: In the yeast the poly (A) signal sequences are present which are short sequences and redundant in…
Q: Below is a representation of a pre-mRNA. Numbers represent exons, and letters represent introns:…
A: Transcription is a process through which the doucle stranded DNA transcribes itself into a single…
Choose the DNA sequence from which this mRNA sequence was
transcribed: 5′-AUACGAUUA-3′.
a. 3′-TATGCTAAT-5′ c. 3′-UAUCGUAAU-5′
b. 3′-UTUGCUTTU-5′ d. 3′-CTCAGCTTC-5′
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and 3' ends. b. translate this RNA sequence in 1a into a protein sequence c. Give the sequence of mRNA that would be transcribed off of the top strand and label its 5' and 3' ends. d. Translate this RNA sequence in 1c into a protein sequenceUse the Genetic Code below to help you answer the following questions. The nucleotide sequence of a hypothetical eukaryotic gene is: 3'- CCC CAT CAG TCA AGG GAA - 5' a. Provide the mRNA of the non-mutated gene. b. Provide the linear amino acid sequence of the non-mutated gene. üü c. Examine the mutated DNA sequence below. What would be the sequence of the mRNA? ü Mutated DNA sequence: 3' CCC CAC AGT CAA GGG AA 5' d. Provide the linear amino acid sequence of the mutated gene and identify the type of mutation. e. Comment on the consequences of this type of mutation?Eukaryotic mRNA is capped at the 5' end by: a. adding a poly A sequence to the 5' end. b. ligating a 7-methylguanylate via a 3’ linkage. c. methylating the base pairs near the 5’ end. d. forming a lariat structure via transesterification.
- The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome: Choose the sequence that would correspond to that mRNA. A: 3’ – TACGGAACG – 5’ B) 3’ – AUGCCUUGC – 5’ C) 5’ – AUGCCUUGC – 3’ D) 3’ – UACGGAACG – 5’ E) 5’ – UACGGAACG – 3’If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the corresponding gene is... which of the following answers? a. CTCAAGTGTCATCCG b. GCCTACTGTGAACTC c. 3' GAGTTCACAGTAGGC 5' d. GAGTTCACAGTAGGC e. none of the aboveGiven the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deleted
- Process by which the DNA sequences encoding exons are exchanged and reordered through genetic recombination between DNA sequences encoding introns. Group of answer choices a)RNA editing b)Exon Definition c) Exon Shuffling d)TransesterificationWhich sequence is most likely to be found in a promoter? a) CGGTGTATATCGTAC b) GTACAGTCATCCCGT c) AAATCTACTACGATT d) GGGTTGGGTTGGGTTa molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answer
- a. The reading frame DNA sequence is b. The mRNA sequence is c. The polypeptide sequence is a.The mutated polypeptide sequence is b.What kind of mutation was produced?Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-C
