Based on the following titration table of Glycine, would you be able to recreate the same forHistidine?GlicinaIncreasing pHH-N-CH,-COOH-H-N-CH,-co= H-N-CH,-C00-Net charge:+1pHCOOH-pKa = 2.3NH3-pka = 9.6CNAEq+1+12.3(0.5°-1)+(0.5°0)=-0.5+0.50.59.6-1(0.5*+1)+(0.5°0)=+0.5-0.51.514Given that the pKas for Histidine are the following:pka1 = 1.82pKa2 = 9.17pКаз %3 6.00pL = 7.592.

Given, Data for glycine pH pKa-COOH =2.3 pKa-NH3 = 9.6 CN ∆Eq 0 0 +1 +1 0 2.3 -0.5 +1 +0.5…

Answered: Based on the following titration table…

Science

Biochemistry

Based on the following titration table of Glycine, would you be able to recreate the same for Histidine?

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Write structural formulas for the two dipeptides that contain leucine and aspartate.

A: A peptide is the sequence of amino acids which is joined through peptide or amide bond in which…

Q: Which of the following a.B-D-ribose b. thymine c. phosphate which is not a component of…

A: Deoxyribonucleotide means DNA. DNA acts as genetic material in most of the organisms present on the…

Q: Following are Fischer projections for a group of five-carbon sugars, all of which are aldopentoses.…

A: Enantiomers are molecules that are a mirror image of each other. These molecules cannot be placed on…

Q: Identify the source of the atoms in the pyrimidine ring

A: Introduction: Nucleotides are the backbone of DNA and RNA. Purines and pyrimidines are the nitrogen…

Q: Draw Haworth projection formulas for the b-anomer of monosaccharides with each of the following…

A: a. A contains a six carbon chain thus the Haworth projection may either be a six membered ring or a…

Q: In pyrimidine nucleosides the anti conformation predominates because of steric interactions with…

A: Pyrimidine nucleosides have anti-conformation as the oxygen molecule present on the second carbon is…

Q: what is the structure of tyrosyl alanyl glycine

A: Amino acids are the building blocks of the peptide and proteins, they are formed of chiral carbon…

Q: Draw all the possible tripeptides of serine, methionine, and glycine and name them.

A: The peptides that are made up of three amino acid sequence are termed tripeptides. These amino acids…

Q: What is the structural difference between thymine and uracil?

A: The DNA and RNA are made up of long strands of nucleotides which are attached to each other by…

Q: What is the pI value for the dipeptide Gly-Ala?

A: The pI or isoelectric point is the pH value at which the molecule or the peptide carries no electric…

Q: List down the isomers of the tripeptide Ala-Cys-Lys.

A: Amino acids are the building blocks of the proteins. There are 20 amino acids which are commonly…

Q: draw a peptide bond of: glycine alanine proline

A: The amino acids are the monomers for the protein chains. The amino acid has a chiral carbon attach…

Q: A derivative of a triterpene that contains four fused rings is referred to as a _____________.

A: A class of the chemical compounds that are made up of 3 terpenes units is known as triterpenes with…

Q: how does the sphingosine affect the physical properties of sphingomyelin?

A: Sphingosine: it is an important part of sphingolipids with unsaturated hydrocarbon chain. It belongs…

Q: Given a primer sequence 3’- CTGGGAAACATTCTGGAT - 5’, compute for the melting temperature of this…

A: Melting temperature of primer can be defined as a temperature at which one half of the DNA double…

Q: Which four different bases can be bound to deoxyribose?

A: Nucleosides are a combination of a nitrogen base with pentose sugar. The nitrogen base combines with…

Q: What special purpose methionine serves

A: Methionine is referred to as an amino acid comprises of the sulphur group responsible for forming…

Q: Which amino alcohol is used in the synthesis of sphingomyelin?

A: Amino alcohol: It is a compound that contains both an Alcohol group (OH) and an Amine group. It is…

Q: Is the sugar in the nucleotide deoxytibose or ribose? How do you know?

A: DNA/RNA is made up of monomers of nucleotides .

Q: Nucleotides containing ribose, thymine, and phosphate are not found in ribonucleic acids. Explain…

A: RNA consists of ribonucleic acid, which exhibit ribose, and nitrogenous bases.

Q: Identify each of the following Haworth projection formulas as an a-D monosaccharide or a ß…

A: In alpha-D-monosaccharide, the -OH on C-1 and -CH2OH on C-5 are on opposite side and this is reverse…

Q: Describe the steric interactions that determine the conformations that pyrimidine nucleosides…

A: Pyrimidine is an organic compound which has heterocyclic ring. It fuses with the nitrogenous bases…

Q: Classify the following nitrogenous bases into purines or pyrimidines.

A: Purines : Adenine and Guanine are purines . Pyrimidines : Thymine , Cytosine and Uracil are…

Q: If thymine nucleotides are degraded by the same enzymes as those catabolizing uridine nucleotides,…

A: The cleavage of the ring structures metabolizes thymine and uracil nucleotides. The usual end…

Q: How could you make the zwitterion of aspartic acid more soluble in water?

A: A zwitterion is considered as a chemical compound, which has both charges positive as well as…

Q: Draw the structure of alanylglutamylglycyllysine.

A: Peptides are nothing but small condensation products derived from amino acids. They appear small…

Q: D- and L- designations are used to distinguish between the two possible enantiomers of the…

A: Fischer projections are the two-dimensional representations of the atomic connectivity and…

Q: What are pyrimidine dimers ?

A: Nucleic acids are macromolecules comprised of carbon, hydrogen, oxygen, nitrogen, and phosphorus.…

Q: There are a total of six different amino acid sequences for a tripeptide containing one molecule…

A: Any peptide that is obtained by a set of three amino acids joined together is known as a tripeptide.…

Q: What is the significance of Deoxyribonucleotide?

A: Deoxyribonucleotide refers to a type of nucleotide that contains the deoxyribose sugar, a phosphate…

Q: What is the pI for histidine?

A: Histidine is an essential amino acid that cannot be synthesized by the body and needs to be…

Q: Draw the Titrimetric profile of Lysine

A: Lysine is one of 10 essential amino acids. It is a linear, positively-charged amino acid.

Q: Would the tetrapeptide W-X-Y-Z have the same pl as a peptide Z-Y-X-W? Why or why not?

A: The isoelectric point is the pH at which any molecule (here it would be the amino acids) carries no…

Q: Why 14C@phenylalanine is used ?

A: The usage of high-velocity counter-modern chromatography has an effect on nitrogen/carbon ratio and…

Q: What is N-formylmethionine (fMet). ?

A: Proteins are the building blocks of the body. It plays an essential role in the body. Proteins are…

Q: Which of the following is least soluble in hexane?

A: Fatty acids (FA) are aliphatic chain with carboxylic acid group, which is non-polar molecule. This…

Q: BrominedeoxyUridine (BrdU) is a thymidine analog. What does the word analog mean in biochemistry and…

A: The genetic material is all the living organism is the DNA (deoxyribonucleic acid). All the…

Q: Name the following nucleotide.

A: it is a nucleotide because it has a sugar a nitrogenous base and a phosphate group.

Q: what is the structure of phenylalanyl tyrosyl seryl histidine

A: Amino acids are the molecules that are used to form protein or peptides by their joining with a…

Q: Draw the four stereoisomers of threonine as Fischer projections.

A: BASIC INFORMATION BIOMOLECULES These are the molecules that are made up of the biological elements…

Q: Following are structural formulas for cytosine and thymine. Draw two additional tautomeric forms for…

A: The isomers which differ in the position and electrons and the carbon skeleton is same are said to…

Q: Identify all the possible products when the tripeptide Ala-Val-Ala undergoes partial hydrolysis

A: Proteolytic enzymes hydrolyze proteins at optimum temperature and pH and cleaves bonds between them.…

Q: What structural relationship is indicated by term D-sugar? Why are +glucose and -fructose classified…

A: D and L configuration is shown by the chiral compounds. A chiral carbon is the one which is attached…

Q: What is the pI value of phosphoglucomutase?

A: Phosphoglucomutase is a chemical that moves a phosphate bunch on an α-D-glucose monomer from the 1'…

Q: Which of the following four general statements is TRUE regarding this tetrapeptide?

A: Given a tetrapeptide having residue 1 as acidic, residue 2 proline, residue 3 cysteine and residue 4…

Concept explainers

Metabolic pathways

Metabolism is defined as the group of life-supporting, enzyme-mediated chemical reactions in organisms. A metabolic pathway is a set of these chemical reactions that involve anabolism (synthesis of complex biomolecules) and catabolism (breakdown of biomolecules into small molecules) that occur inside a cell. Metabolites are the reacting substances, products, and intermediate substances of an enzymatic process that are altered by a series of chemical events catalyzed by enzymes.

Question

Based on the following titration table of Glycine, would you be able to recreate the same for
Histidine?
Glicina
Increasing pH
H-N-CH,-COOH
-H-N-CH,-co
= H-N-CH,-C00-
Net charge:
+1
pH
COOH-pKa = 2.3
NH3-pka = 9.6
CN
AEq
+1
+1
2.3
(0.5°-1)+(0.5°0)=-0.5
+0.5
0.5
9.6
-1
(0.5*+1)+(0.5°0)=+0.5
-0.5
1.5
14
Given that the pKas for Histidine are the following:
pka1 = 1.82
pKa2 = 9.17
pКаз %3 6.00
pL = 7.59
2.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Penicillin G is a natural antibiotic that is useful for treating infections caused by Gram positive bacteria. What is the functional benefit of the semi-synthetic antimicrobials carbenicillin and ampicillin, generated by chemical modification of the R group so their R groups each are a bit different than the R group seen with penicillin G?
Draw tripeptide Lys-Thr-Glu at pH 7.4 and circle the six atoms that are restricted in the same plane.
What is the net average charge on the predominant form of lysine at pH values of (a) 2.0, (b) 5.0and (c) 7.0?
you have isolated the following peptide: His-Ser-Arg- Ala-Glu- Leu- Pro- Gly Calculate the approximate charge of the peptide at Ph 1, 3, 5, 8, 11, 14 AND what is the PI of this peptide?
How many charged functional groups will be found on serine at physiological pH?
What is the melting temperature and G/C content of the following primers? a.) 5’ GAAATAATTTTGTTTAACTTTAAG 3’ b.) 5’ GTAACTCAGCTTTCAGGTCG 3’
The 6-member pyranose ring of glucose is formed through the interaction of the hydroxyl group on C5 with the aldehyde group What kind of ring is formed when the hydroxyl group on C4 attacks instead? Draw the Haworth projection of the products with all the carbons labelled accordingly and name them Why would ring formation through C6 or C3 be unfavorable?
The net charge on the most prevalent form of bisphosphoglycerate in blood is what?
Calculate and draw the isoelectric point of the tetrapeptide Ser-Leu-Phe-Pro at pH 7.0. hand written please
A tripeptide has the following sequence: Glu-Trp-Arg What is the net charge of this tripeptide at physiological pH?
Starting from glutamine ,glycine, aspartate, N-10 formal-ThF ,how many ATP equivalents are required for purine synthesis?
Write the structure of the following peptides: 1. glycyl alanine 2. tyrosyl alanyl glycine 3. phenylalanyl tyrosyl seryl histidine 4. valyl glycyl cystein 5. seryl methionine