Before a cell divides, it duplicates its DNA in a process called Replication. During this process, the DNA molecule unzips into two strands that serve as templates. The enzyme DNA Polymerase joins individual

Before a cell divides, it duplicates its DNA in a process called Replication. During this process, the DNA molecule unzips into two strands that serve as templates. The enzyme DNA Polymerase joins individual

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 5SQ: A set of cells that host various DNA fragments collectively representing an organisms entire set of...

See similar textbooks

Related questions

Q: The fragment of DNA in replication are called______fragments.

A: During DNA replication ,double helix is unwound and the complementary strands are separated with the…

Q: What happens at the conclusion of DNA replication?a. The daughter double helices each consist of one…

A: Deoxyribonucleic acid or DNA is cellular genetic material that is present as double helical…

Q: The diagram shows an important biological molecule going through the process of replication. Which…

A: Answer: REPLICATION OF DNA = It is one of the important process of central dogma in which DNA is…

Q: Compare and contrast the DNA and chromosome

A: Inheritance is the process by which this genetic information present in the genes is passed on from…

Q: Describe DNA replication

A: DNA ( deoxyribonucleic acid ) is double helical , ladder like structure which is genetic material in…

Q: The enzyme responsible for adding new nucleotides to a growing DNA chain during DNA replication is…

A: DNA is the nucleic acid that stores genetic information.

Q: _________ unwinds DNA.

A: DNA is the genetic material which is formed by the polymerization of nucleotides. DNA Store the…

Q: Polymerase chain reaction mimics the cells ability to: translate mRNA into protein transcribe dna…

A: Polymerase chain reaction or PCR rapidly replicates specific DNA fragments without cloning in cells.

Q: Q5

A: Introduction Mutation: any changes in the sequence in the genetic material which leads to disorders…

Q: Choose the combination of answers that most accurately completes the statement. DNA replication is…

A: Answer- DNA is semiconservative in nature, It was proposed by Francis Crick.

Q: The synthesis of new DNA requires energy. Where does this needed energy come from? The DNA…

A: DNA polymerases are the enzyme that replicate DNA in cells. DNA polymerase can not create new strand…

Q: Replication of DNA begins at and transcription of RNA begins at

A: In DNA replication the double-stranded molecule of DNA is copied for making two identical DNA…

Q: DNA mutations that change DNA sequence occur during: 1) replication 2) transcription 3) translation…

A: Different processes essential for cell functioning occur inside the cell. DNA replication, its…

Q: In a DNA double stranded molecule, if 5% of the bases are cytosine, what percent of the bases are…

A: [Deoxyribonucleic acid ]DNA It's an organic compound which includes genetic data & protein…

Q: DNA can copy itself through a process known as _____.

Q: Before a cell divides, it duplicates its DNA in a process called Replication molecule unzips into…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: DNA _______________ adds an RNA primer that is complement to the template strand of DNA

A: DNA replication is the process in which DNA copies are made. it semiconservative, meaning that each…

Q: True or False: Enzymes known as DNA polymerase assemble new DNA strands into a proper base sequence…

A: True

Q: enzyme called________ lats down the initial short piece of template RNA.

A: In Prokaryotes, During DNA replication the first step is to unwound the ds DNA and here the enzyme…

Q: Makes a DNA copy from a piece of RNA [Choose ] Reverse Transcriptase

A: In the method of Reverse Transcription ( RNA dependent DNA polymerase) convert Ribo nucleic acid…

Q: Compare DNA replication with transcription

A: Step 1 Replication is an essential property of genetic material. It is the formation of exact carbon…

Q: Which series is arranged in order from largest to smallest? Chromosomes, nucleus, cell, DNA,…

A: Introduction The cell is the smallest unit that can live on its own and that makes up all living…

Q: DNA replication results in the creation of _____________ identical strands of DNA.

A: The consequence of DNA replication is two DNA molecules comprising of one new and one old chain of…

Q: An enzyme called _____________________ catalyzes theformation of a covalent phosphodiester bond…

A: DNA replication is the process of formation of complementary strands of DNA molecules from the…

Q: Describe how nucleotides are connected to a growing DNA strand.

A: Deoxyribonucleic acid (DNA) replication is the biological process of producing two identical…

Q: The enzyme known as ________ uses ________ and separates the DNA strands at the replication fork. a.…

A: DNA Replication is the biological process of generating exact copies of DNA from the original DNA…

Q: When DNA is read by RNA synthase, mRNA is made. What is the name of the enzyme that reads DNA and…

A: DNA (deoxyribonucleic acid) is the genetic material of all the organisms on the planet except a few…

Q: where does DNA synthesis take place

A: DNA : It is the chemical name for the molecule that carries genetic instructions in all living…

Q: DNA replication is semi-conservative and results in each new cell receiving a copy composed of 1 new…

A: DNA or deoxyribonucleic acid is the biomolecule that carries the genetic information in a coded form…

Q: The process of forming RNA from DNA is called a. mitosis. b. DNA replication. c. translation. d.…

A: Transcription is the first step involved in gene expression wherein a small DNA segment is copied to…

Q: Compare and contrast DNA replication with Protein Synthesis

A: The similarities are both Protein synthesis and DNA replication, DNA is involved. These both occurs…

Q: _____________ is responsible for adding new nucleotides to the DNA strand being created.

A: Two long polynucleotide chains made up of four diverse nucleotide sub units make up a DNA particle.…

Q: Adds nucleotides in the 5' to 3' direction during DNA replication.

A: The biological process of making two identical DNA copies from a single original DNA molecule is…

Q: You have designed a drug to stop the DNA replication process in cancerous cells. Explain how your…

A: Cancer or malignancy is a condition in which the affected cells lose the normal control mechanism…

Q: What is the role of DNA polymerase in DNA Replication? unwind and unzip the DNA repair errors reads…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: DNA synthesis always occurs starting at the _____________ end and moving toward the ______ end.

A: DNA polymerases can add deoxyribonucleotides only to the 3' end of a growing DNA chain.

Q: In which direction, the new strand of DNA synthesised during DNA replication.

A: DNA is the information hub of the cell that contains instructions regarding protein synthesis. It is…

Q: Which step of DNA replication occurs BEFORE DNA polymerase extends the new strand of DNA? - a…

A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…

Q: Does all DNA have a function? Is all of the DNA in your genome, for example, part of a gene? Explain…

A: Deoxyribonucleic acid is a polymer made of two polynucleotide chains which wrap around one another…

Q: Chromosomes contain large molecules known as a Mitochondria b Lacunae C DNA d Viron Check It

A: Nucleus is the most controlling feature of a cell. It contains thread like structures called…

Q: Removes RNA primer and replaces it with newly synthesized DNA.

A: A primer is a single-stranded nucleic acid that all living organisms utilize to start the production…

Q: During DNA replication, half of the strand is conserved in the new molecules cteated. This is called…

A: Formation of new DNA from the old DNA is known as DNA replication. DNA replication occurs within the…

Q: Describe the job of DNA in a cell.

A: DNA is a type of nucleic acid also called as the polynucleotide. Nucleotide consists of a pentose…

Q: DNA polymerase starts adding new nucleotide at an RNA______________.

A: For the mechanism of replication of DNA, DNA polymerase is responsible, since two similar DNA…

Q: Transcription is..... dependent..... synthesis.

A: DNA/RNA

Q: The ______________ is where DNA replication begins

A: DNA replication is the process by which a double stranded DNA molecule is copied to produce two…

Q: The process of ______ copies DNA, ______ makes an RNA molecule from a DNA template, and ______…

A: Replication is the process by which a double stranded DNA molecule is copied to produce two…

Q: biological and reproductive purpose of DNA in words.

A: Structure of DNA Double Helix structure of DNA was proposed by Watson and Crick based on the X-ray…

Question

Can you please help me on the last two.

Flay Kehoot-Erte
Desmos | Testing
9 Schoology
Esyside Fore Page ts Elemental - Ele.
Last edit was 44 milnuTEs ago
OOIS
Add-ons Help
Theme
Transition
9 Background Layout
I I I II
REPLICATION Fil in he Blanks.
Word Bank
(Note: Not all words will
be used)
Before a cell divides, it duplicates its DNA in a process
called_Replication. During this process, the DNA
molecule unzips into two strands that serve as templates.
The enzyme DNA Polymerase joins individual
Nucleotides to the original DNA strands following
pairing. Each new growing strand
Base
Helicase
Polymerase
Complimentary
Transcription
Replication
Sugar
Nucleotides
the rules of
Amino Acids
is called the
or matching, strand.
TYPE

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Explanation

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
5’ ATGCTAGACGTGTTCTAG 3’3’ TACGATCTGCACAAGATC 5’Moving from left to right, the bottom DNA strand will be read continuously.a. Tb. F
Complete the complementary strand: DNA replication ATTCGAGGCTAA
I'm struggling with understanding DNA replication, more specifically transcription and translation (5' and 3' opposite orrientations). Could you help to explain this? Thanks!
GIVEN: DNA CODING STRAND: GCG TAC TTT TCA GGT DNA TEMPLATE STRAND ____ ____ ____ ____
DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND DNA? also what's the arrangement of m-RNA and the chain arrangement of the amino acids that will be made according to the order of the RNA?PLS DONT ANSWER THE DEFINITION ONLY, READ THE QUESTION CAREFULLY
a) what si the nucleotide at the 5 prime end of the picture? b) what si the DNA sequence from 5 prime to 3 prime pls help, urgently required, no explanation needed
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
Hi, I just need the answers not the explanition. Thank you so much 1- Replication of DNA is (????), meaning that when DNA is replicated each strand becomes a template for the new strand. -Semiconservative -Conservationist -Neoconservative 2-Replication of DNA begins at special sites called (????). -Origins of replication. -Replisomes -Photosystems -Chez replique 3- The end result of oxidative phosphorylation is the production of (????) that will be used to power other cellular reactions -ATP -Electrons -Higgs bosons -Glucose
Please ASAP. Thanku The process by which base pairs combine with each other to form a strand of DNA is called _______. denaturation annealing initial incubation extension mitosis
The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And also the mutation type