When DNA is read by RNA synthase, mRNA is made. What is the name of the enzyme that reads DNA and makes more DNA?

Q: Describe the process of protein synthesis and localize where each step takes place. Use the…

A: Protein synthesis is one of the major processes, which helps in the synthesis of protein for the…

Q: Which is the correct order from smallest to largest? 1) nucleotide, codon, gene, chromosome 2)…

A: In 1866, Mendel discovered the principle of heredity, demonstrating that genes are found in the…

Q: Before a cell divides, it duplicates its DNA in a process called molecule unzips into two strands…

A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: A mutation takes place during replication and the new DNA strand has the sequence 3'-ATG-5' What is…

A: The genetic code is a triplet code called a codon. The indicated amino acid can be specified by more…

Q: Compare the base pair of DNA to the base pair of RNA?

A: Protein synthesis takes place within the nucleus and ribosomes of a cell and is regulated by DNA and…

Q: What is the correct order of the stages of DNA synthesis? A) Unwinding the DNA, synthesis of a…

A: The manufacture of deoxyribonucleic acid (DNA) molecules, whether natural or artificial, is known as…

Q: Fill in the blank with the most appropriate term that is described by the following statement:…

A: Introduction Ribonucleic acid, or RNA, is a long, single-stranded protein-processing chain found in…

Q: Diagram a segment of DNA, labeling all important chemical groups within the molecule.

A: DNA, also known as deoxyribonucleic acid is the molecule in living organisms that is responsible for…

Q: Human genetic material is represented in the diagram below. A The region labeled A is made up of a…

A: Genes include the bases that are used to assemble protein and RNA. The human genome has a wide…

Q: enzyme called________ lats down the initial short piece of template RNA.

A: In Prokaryotes, During DNA replication the first step is to unwound the ds DNA and here the enzyme…

Q: mRNA comes from the ______________ and goes to the __________________. a. DNA, Ribosome b. DNA, RNA…

A: Step 1 RNA or ribonucleic acid is a single-stranded mixed polymer of four types of ribonucleotides,…

Q: Errors in DNA are called mutations. what are some good and bad consequences of mutations

A: A mutation is a change in a genetic sequence. While most mutations are neutral , some can either by…

Q: what enzyme is needed to make mrna

A:

Q: What is the nitrogen base only in RNA? A C

A: Step 1 Nucleotides are made up of three subunit molecules – nucleobase, pentose sugar, and three…

Q: How many “letters” of an RNA molecule, in sequence,does it take to provide the code for a single…

A: Ribonucleic acid (RNA) are polymeric organic molecules, which are essential for carrying out various…

Q: DNA replication results in the creation of _____________ identical strands of DNA.

A: The consequence of DNA replication is two DNA molecules comprising of one new and one old chain of…

Q: Use the codon table shown above to help answer this question. What protein sequence would a cell…

A: The mRNA sequence is: 5' CCAUGCACCAAUAGAUAACCG 3' The Codon is read in triplet form.

Q: Describe how nucleotides are connected to a growing DNA strand.

A: Deoxyribonucleic acid (DNA) replication is the biological process of producing two identical…

Q: During which process is MRNA synthesized from a DNA template with the aid of RNA polymerase? O…

A: Introduction  Genome is referred to the total amount of DNA a single haploid cell contains. Genome…

Q: Compare the structure, location, and function of DNA and RNA in a chart below

A: DNA is a is normally been described that it's far the molecule this is decided withinside the…

Q: Describe how a molecule of RNA is synthesized using a DNA molecule as atemplate.

A: Introduction :- Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that…

Q: ______ molecules deliver amino acids to the site of protein synthesis. a. DNA b. mRNA c. rRNA d.…

A: The process of translation occurs in which proteins are synthesized with the incorporation of amino…

Q: DNA is used to make and RNA is used to make RNA, proteins RNA, DNA Proteins, DNA Extra DNA, TRNA

A: *The answer of the question is option 1 that is RNA and Proteins. * DNA is used to make RNA and RNA…

Q: What is it about DNA and its relationship to RNA that allows the information in DNA to be used in…

A: RNA, which contains uracil (U) rather than thymine, conveys the code to protein-production…

Q: What would be the mRNA strand if the DNA strand reads: T A C C G A G T C A C G?

A: The process of transcription starts as the DNA of a gene serves as a template for complementary…

Q: Which process best describes the process of transcription? DNA strands open and both strands are…

A: 1. The process that best describes the process of transcription is: DNA strands open and one strand…

Q: If a sequence of bases on a DNA molecule is GATTACA, what would complimentary MRNA strand look like?…

A: The sequence of bases on a DNA molecule GATTACA the mRNA sequence will be CUAAUGU. Option B

Q: Write down some function of Mrna?

A: mRNA stands for messenger RNA. The process of the formation of messenger RNA from the DNA is called…

Q: Synthesize mRNA strands from the DNA templates

A: The DNA consists of two strand template strand and complementary strand. The molecule of DNA…

Q: 1. Define a chromosome, gene and DNA? 2. Discuss gene expression from transcription to translation.

A: All the organisms on our planet survive due to maintaining metabolic and physiological activity…

Q: Which is the complementary strand of RNA?

A: RNA is the ribonucleic acid that plays various important functions in decoding, coding, gene…

Q: Explain how the function of RNA differs from the function of DNA.

A: A gene is the fundamental physical and functional unit of heredity. Genes are comprised of DNA. A…

Q: Which mRNA would be made if the sequence of the DNA coding strand is GAC? O GAC O GTC O GUC O CUG

A: Amino acids are organic compounds with amino and carboxyl functional groups as well as a side chain…

Q: Explain the steps in DNA Translation

A: The translation is the decoding of the genetic code found within a messenger RNA (mRNA) molecule to…

Q: What is the role of Nucleotides in DNA replication

A: In molecular biology, DNA replication is the biological process of producing two identical DNA…

Q: An enzyme that makes covalent bonds between nucleotide sequences in DNA is: O A) RNA polymeraco

A: DNA ( Deoxyribonucleic acid ) is made up of two anti parallel polynuceotide chains which coil around…

Q: Before a cell divides, it duplicates its DNA in a process called Replication. During this process,…

A: DNA replication can be defined as a biological process by which two identical copies of DNA are…

Q: DNA does not participate directly in the synthesis of proteins. What molecule transfers the…

A: RNA molecules transfer the information from DNA to the site of protein synthesis during replication…

Q: The __________ strand is made in fragments called ___________.

A: Semi-conservative replication, also known as DNA replication, is a biological mechanism that…

Q: Why does DNA have to turn into RNA before it can make a protein? why cant DNA just make the proteins…

A: Nucleic acids carry the genetic information of our body. The genetic information is like an…

Q: What protein is responsible for reading the mrna strand and creates protein(polypeptide)

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: What is the name of the enzyme that digests DNA?

A: DNA (deoxyribonucleic acid) is the genetic material of almost all living organisms. It is a double…

Q: Sketch    a    DNA    molecule    to    show:    double    strands,    complementary    base…

A: Answer

Q: DNA polymerase knows what nucleotide add next because it reads the ______________ strand.

A: DNA can add nucleotide to the end of 3rd strane only.

Q: After RNA polymerase binds to DNA, it begins making mRNA. What is the name of this process?

A: According to the central dogma, the most common arrangement of information in our cells is: Making…

Q: The code on a DNA strand reads G C G T A A T G A. The mRNA strand would read:

A: Given: The code on a DNA strand reads GCGTAATGA.

DNA and RNA

Deoxyribonucleic acid (DNA) is usually called the blueprint of life. Deoxyribose is a monosaccharide that has a key function in the synthesis of deoxyribonucleic acid. One less oxygen-containing hydroxyl group occurs in deoxyribose sugar. Nucleic acid, deoxyribonucleic acid, is one of the natural components. Deoxyribonucleic acid is a double-stranded molecule. Watson and Crick postulated the double-stranded model of the helix. A deoxyribonucleic acid is a molecular group that carries and transmits genetic information from parents to offspring. All eukaryotic and prokaryotic cells are involved.

DNA as the Genetic Material

DNA, or deoxyribonucleic acid, is a long polymeric nucleic acid molecule discovered in the late 1930s. It is a polymer; a long chain-like molecule made up of several monomers connected in a sequence. It possesses certain characteristics that qualify it as a genetic component. Certain organisms have different types of nucleic acids as their genetic material - DNA or RNA.

Genetics

The significant branch in science which involves the study of genes, gene variations, and the organism's heredity is known as genetics. It is also used to study the involvement of a gene or set of genes in the health of an individual and how it prevents several diseases in a human being. Thus, genetics also creates an understanding of various medical conditions.      

DNA Replication

The mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of its own is defined as DNA replication. The DNA molecules utilize a semiconservative method for replication.