Adds nucleotides in the 5' to 3' direction during DNA replication.
Q: The fragment of DNA in replication are called______fragments.
A: During DNA replication ,double helix is unwound and the complementary strands are separated with the…
Q: _________ unwinds DNA.
A: DNA is the genetic material which is formed by the polymerization of nucleotides. DNA Store the…
Q: Joining two DNA molecules using DNA ligase. Ligation. O Adhesion. Linker Linkage.
A: DNA fragment is joined with another DNA fragment by the formation of phosphodiester bond. Enzyme…
Q: Choose the combination of answers that most accurately completes the statement. Messenger RNA is…
A: Genetics is the investigation of heredity. Heredity is a natural interaction whereby a parent passes…
Q: DNA replication occurs in short fragments
A: DNA replication is a semi-conservative process of copying one deoxyribonucleic acid (DNA) strand and…
Q: Replication of DNA begins at and transcription of RNA begins at
A: In DNA replication the double-stranded molecule of DNA is copied for making two identical DNA…
Q: write the difference between DNA and RNA. Also compare the function of DNA and RNA . ( please…
A: The differences between the DNA and RNA are given below.
Q: differentiates the DNA from RNA.
A: DNA: It stand for deoxyribonucleic acid, which is a molecule that contains the instructions an…
Q: DNA _______________ adds an RNA primer that is complement to the template strand of DNA
A: DNA replication is the process in which DNA copies are made. it semiconservative, meaning that each…
Q: True or False: Enzymes known as DNA polymerase assemble new DNA strands into a proper base sequence…
A: True
Q: Describe the structure of DNA and explain how the structure of DNA supports the function of DNA
A: DNA is a long polymer of deoxyribonucleotides. The length of a DNA is defined as the number of…
Q: Explain the process of DNA replication.
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…
Q: The replication forks are where DNA ____________ is actively taking place.
A: Replication forks are the sites where two important processes occur; DNA unwinding and DNA…
Q: Makes a DNA copy from a piece of RNA [Choose ] Reverse Transcriptase
A: In the method of Reverse Transcription ( RNA dependent DNA polymerase) convert Ribo nucleic acid…
Q: Describe how the synthesis of new DNA strands begins at anorigin of replication.
A: Replication is the process of formation of copy of DNA strand.
Q: DNA polymerase replicates DNA producing a _______ strand.
A: Answer: DNA polymerase replicates DNA producing a new complementary strand. Explanation: Duplication…
Q: A total of 16 DNA molecules are produced by how many rounds of replication
A: Introduction Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…
Q: dentify two important enzymes involved in the replication.
A: There are two important enzyme involved in the replication of DNA DNA Polymerase primase DNA…
Q: DNA replication results in the creation of _____________ identical strands of DNA.
A: The consequence of DNA replication is two DNA molecules comprising of one new and one old chain of…
Q: An enzyme called _____________________ catalyzes theformation of a covalent phosphodiester bond…
A: DNA replication is the process of formation of complementary strands of DNA molecules from the…
Q: Describe how nucleotides are connected to a growing DNA strand.
A: Deoxyribonucleic acid (DNA) replication is the biological process of producing two identical…
Q: The enzyme known as ________ uses ________ and separates the DNA strands at the replication fork. a.…
A: DNA Replication is the biological process of generating exact copies of DNA from the original DNA…
Q: A single strand of DNA runs from ___________ to ___________.
A: Every DNA strand has two closures. The 5' end of the DNA has the terminal phosphate group on the 5'…
Q: Once replication begins, it will continue in both ______________ along the DNA strand.
A: Replication Replication is the process of doubling of DNA molecules. In this, both strands of DNA…
Q: DNA replication is semi-conservative and results in each new cell receiving a copy composed of 1 new…
A: DNA or deoxyribonucleic acid is the biomolecule that carries the genetic information in a coded form…
Q: uring DNA replication the synthesis of the leading strand of DNA results in fragments known as:…
A: During cell division, DNA replication is the process by which DNA duplicates itself. A replication…
Q: Compare and contrast DNA replication with Protein Synthesis
A: The similarities are both Protein synthesis and DNA replication, DNA is involved. These both occurs…
Q: _____________ is responsible for adding new nucleotides to the DNA strand being created.
A: Two long polynucleotide chains made up of four diverse nucleotide sub units make up a DNA particle.…
Q: The enzymes responsible for forming the final phosphoiester bond between two DNA fragments during…
A: The phosphodiester bonds constitute the backbone of the strands of DNA.
Q: DNA positively supercoils during replication and negatively supercoils in transcription.
A: Transcription is a process where DNA replicate into RNA, while replication is the making of DNA…
Q: DNA polymerase adds nucleotides to the new strand in the ___________ to _____________ direction.
A: At the time of synthesizing new DNA, free nucleotides can be added by DNA polymerase only to the 3'…
Q: DNA wrapped around a
A: The DNA is comprised of a packed organelle of a structure called a chromosome. The chromosome is…
Q: . General recombination occurs between _____________ DNA molecules
A: Recombination is considered as a process, during which new combinations are produced out of it,…
Q: In which direction, the new strand of DNA synthesised during DNA replication.
A: DNA is the information hub of the cell that contains instructions regarding protein synthesis. It is…
Q: Write detailed comments on the purity of the DNA
A: DNA is a double-helical structure of polynucleotide chains. It contains all hereditary information…
Q: Draw a DNA replication diagram
A: * The Messelson Stahl experiment is conducted by Matthew messelson and Franklin stahl which…
Q: What is the role of Nucleotides in DNA replication
A: In molecular biology, DNA replication is the biological process of producing two identical DNA…
Q: Before a cell divides, it duplicates its DNA in a process called Replication. During this process,…
A: DNA replication can be defined as a biological process by which two identical copies of DNA are…
Q: Removes RNA primer and replaces it with newly synthesized DNA.
A: A primer is a single-stranded nucleic acid that all living organisms utilize to start the production…
Q: DNA polymerase starts adding new nucleotide at an RNA______________.
A: For the mechanism of replication of DNA, DNA polymerase is responsible, since two similar DNA…
Q: DNA polymerase
A: For DNA to under replication it requires different proteins and enzymes. They are, DNA polymerases,…
Q: DNA replication is a semi-conservative process
A: In molecular biology, DNA replication is the process of synthesizing two identical copies of DNA…
Q: Transcription is..... dependent..... synthesis.
A: DNA/RNA
Q: The ______________ is where DNA replication begins
A: DNA replication is the process by which a double stranded DNA molecule is copied to produce two…
Q: Which compound represents the basic unit of both a DNA molecule and a RNA molecule? I-0-I I-6-I…
A: Biomolecules are chemical substances produced by a cell to maintain its function. They vary in size,…
Q: Describe the process (steps) of DNA replication. roph
A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…
Q: Sketch a DNA molecule to show: double strands, complementary base…
A: Answer
Q: Explain steps in DNA replication with words and pictures
A: DNA replication occurs in the cytoplasm of prokaryotes and in the nucleus of eukaryotes. DNA…
Q: DNA polymerase knows what nucleotide add next because it reads the ______________ strand.
A: DNA can add nucleotide to the end of 3rd strane only.
![function/role:
Adds nucleotides in the 5' to 3' direction during DNA replication.
[ Select ]
[ Select ]
DNA polymerase III
single stranded binding proteins
primase
helicase
sliding clamp
primer
ligase
peptidyl transferase
sigma factor
DNA polymerase I
antisense strand
aminoacyl TRNA synthetase
RNA polymerase
DNA gyrase
codon](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F0ebba1cb-7b8d-4edb-a729-eb45140da03b%2F8c268b56-95bd-402d-bf0c-e5e7647d86f3%2F03aeie5_processed.jpeg&w=3840&q=75)
Step by step
Solved in 3 steps
- Identify the enzyme/protein involved in replication: multiple choice Addition of short RNA primers at the leading and lagging stranda) dna ligaseb. dna proteinsc. dna gyrased. single-strand binding proteinse. primasef. helicaseg. 5' - 3' polymeraseh. RNA polymerasei. other:_A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made
- DNA Replication Terms _____DNA polymerase III _____Primase _____Helicase _____Lagging Strand _____Leading Strand _____RNA Primer _____Single Strand Binding Protein _____5’ _____3’ _____DNA Ligase _____ Topoisomerase _____Template Strand _____Coding StrandHow would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymeraseDuring eukaryotic DNA replication, _________ synthesizes short RNA primers. The primers provide a 3'-OH group to which DNA nucleotides are be added by DNA polymerase. DNA gyrase (topoisomerase) DNA helicase DNA ligase primase
- Multiple choice DNA polymerases can only elongate from: -Free 3’ hydroxyl groups -The area ahead of the sliding clamp -Okazaki Fragments -The 5’ end of the lagging strand and The ______ of the EGFR allows coupling with another monomer. -Dimerization arm -Conformation arm -Polarization arm -Signaling arm5' ATTTACGTTTT 3' 3' TAAATGCAAAA 5' Need help drawing a diagram showing the replication fork at the beginning of the ORI that includes the leading strands, lagging strands, snd the Okazaki fragments of the ORI templateDNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Give the discussion of the entire procedure
- Match the statement to the corresponding agent/key player in DNA replication. Some items require more than one answer. choices: Origin of replication Bubble SSBP RPA Sliding Clamp PCNA DNA Pol III Pol ε Pol δ DNA Pol I RNAse H Flap 1 DNA gyrase Pol α DNA helicase Primase Single chromosome Multiple points in chromosomes DNA ligase Not applicable Proof reading in prokaryotic DNA material Joins the Okazaki fragments in leading strand Dissociates after adding the few initial nucleotides in eukaryotes Add nuclecleotides to the site of the removed prokaryotic prime Make primers for the replicative enzymes in eukaryotes Primosome in prokaryotes Proof reading in eukaryotic DNA material Holds the processive enzyme in prokaryotes Removal of prokaryotic primerThe region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligase
