Below is a picture of multiple mRNA molecules being transcribed simultaneously from the same myostatin gene. The RNA polymerases transcribing the gene, move from left to right on the picture. A C B Which letter marks the location of: A. the 3' end of the template strand? B. the 3' end of a mRNA? C. the location of a RNA polymerase enzyme? D. the location of a 5' cap?

Below is a picture of multiple mRNA molecules being transcribed simultaneously from the same myostatin gene. The RNA polymerases transcribing the gene, move from left to right on the picture. A C B Which letter marks the location of: A. the 3' end of the template strand? B. the 3' end of a mRNA? C. the location of a RNA polymerase enzyme? D. the location of a 5' cap?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this mRNA? (b) What dipeptide is formed if a mutation converts CUG to CUU? (c) What dipeptide is formed if a mutation converts CAC to CGC? (d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?
Which of the following describes the effect of a frameshift mutations? * A. all mRNA codons change B. some, but not all , mRNA codons change C. there is no change in mRNA codons D. no correct response Consider the following DNA base sequence 3' TTA ATA 5'. what dipeptide is formed if a DNA point mutation converts ATA to ATG? * A. Cys-Phe B. Tyr-Tyr C. Phe-Leu D. Ser-Tyr Consider the following mRNA base sequence 5' ACC CAC 3', what dipeptide is formed if a point mutation converts ACC to ACU? * A. Thr-His B. Thr-Thr C. His- Ile D. Ile- Asp Which of the following statements below is incorrect? * A. the genetic code is overlapping B. the genetic code is universal C. degenerate codon specify the same amino acids…
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNA
Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA? b. What dipeptide is formed if a point mutation converts CUU to CUC? c. What dipeptide is formed it a point mutation converts CAG to AAG?
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
if the following DNA sequence were transcribed, which of the following describes the output of this process? 3'- TCTGGACA-5' A. This would produce a protein that looks like 5'- A G A C C U G U -3' B. This would produce a tRNA that looks like 3'- A G AC C U G U -5' C. This would produce an mRNA that looks like this: 5'- A G AC C U G U -3' D. This would produce an mRNA that looks like 3'- U C U G G A CA -5' E. This would produce another strand of DNA that 0ok like 5-AG ACCT GT-3. ..
Number the following steps of protein synthesis in order in which they occur, starting with 1 and ending with 9. a. ____ the stop codon is reached, and the polypeptide is released b.____ the small ribosomal subunit finds the start codon, and the large ribosomal subunit joins. c.____ the end of the gene is reached, and the pre-mRNA is released and then edited. d. ____ The transcription factor bonds the promoter. e. ____ the protein is folded and modified to become functional. f. ____ RNA polymerase builds the mRNA transcript. g. ____ mRNA and initiator tRNA bind the small ribosomal subunit. h. ____ new tRNAs are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site. i. ____ mRNA exits the nucleus via a nuclear pore.
Number the following steps of protein synthesis in the order in which they occur, starting with 1 and ending with 9.a. _____ The stop codon is reached, and the polypeptide is released.b. _____ The small ribosomal subunit finds the start codon, and the large ribosomal subunit joins.c. _____ The end of the gene is reached, and the pre-mRNA is released and then edited.d. _____ The transcription factor binds the promoter.e. _____ The protein is folded and modified to become functional.f. _____ RNA polymerase builds the mRNA transcript.g. _____ mRNA and initiator tRNA bind the small ribosomal subunit.h. _____ New tRNA molecules are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site.i. _____ mRNA exits the nucleus via a nuclear pore.