By average, how many Sau3A (5’GATC3’) sites are there in a 10 kd DNA molecule? (1/4)^6 * 10,000 = 2.44140625 => 2.4 For the above 10 kb DNA, if you use Sau3A to do a complete digestion, you will only get a lot of small fragments ( 200~500 base pairs). What should I do if I want to get larger digested fragments (say 3 to 5 kb) Please answer asap and type your answer and do not copy from anywhere please

By average, how many Sau3A (5’GATC3’) sites are there in a 10 kd DNA molecule? (1/4)^6 * 10,000 = 2.44140625 => 2.4 For the above 10 kb DNA, if you use Sau3A to do a complete digestion, you will only get a lot of small fragments ( 200~500 base pairs). What should I do if I want to get larger digested fragments (say 3 to 5 kb) Please answer asap and type your answer and do not copy from anywhere please

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers, show how you came up to each result? (a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in mm?
Let’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?
A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?
You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To do so, you must amplify the entire region of AATG repeats. Design primers of 16 bases each so they anneal outside the region of interest. More than one primer pair is possible, but just give one. 5’-ACTGGCACAGAACAGGCACTTAGGAATGAATGAATGAATGAATGAATGAATGACCTGTGTGGTTCCCAGTTCCTCC-3’ 3’-TGACCGTGTCTTGTCCGTGAATCCTTACTTACTTACTTACTTACTTACTTACTGGACACACCAAGGGTCAAGGAGG-5’
If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
. While studying the structure of a small gene that was recently sequenced during the Human Genome Project, an investigator notices that one strand of the DNA molecule contains the following: 20 adenine (A) bases 30 cytosine (C) bases25 guanine (G) bases 22 thymine (T) bases How many of each base is found in the complete double-stranded molecule?
Hơ many mismatches would you expect to find between this sequence and the reference sequence? I know the answer is 3, can you please explain why?
The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers, show how you came up to each result? How many full double-helical turns does this DNA contain?
What part(s) of a nucleotide (namely, phosphate, sugar, and/orbase) is(are) found in the major and minor grooves of doublestrandedDNA, and what part(s) is(are) found in the DNA backbone?If a DNA-binding protein does not recognize a specificnucleotide sequence, do you expect that it binds to the majorgroove, the minor groove, or the DNA backbone? Explain.
The Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.
Type the matching bases in each DNA sequence. G A T A G C T A G G