Q: 6. A man with type B blood marries a woman with type A blood. They have the first child with blood…
A: Blood group A and B are dominant over blood group O. Blood grouping show codominance.
Q: Which of the following substances is unlikely to diffuse across the lipid bilayer of a typical cell…
A: The cell membrane is also known as the plasma membrane. It is made up of two phospholipid layers.…
Q: explain the process of alcohol fermentation. having alot of touble understanding it
A: Fermentation is where microorganisms produce beneficial & desirable changes in food. The process…
Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…
A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…
Q: All of the following can pass through the blood-placenta barrier except... O Toxoplasma gondii…
A: Introduction An organ that grows in the uterus during pregnancy is the placenta. A developing…
Q: CROSS 1 2 3 4 ROOSTER walnut Walnut Walnut walnut CROSS 1 HEN Walnut Single 2 3 4 pea walnut What…
A: Given: In poultry, the shape of the comb may be rose (A_bb), pea (aaB_), walnut (A_B_), or single…
Q: Separation of homologous chromosomes during Meiosis I requires: Select one: a. Removing centromere…
A: A division in which diploid cell reduces the chromosome number into half by cell division and…
Q: xplain how Protein Data Bank (PDB) can assist Dr.
A: protein data bank it enables science and education by providing access and tools for exploration,…
Q: Mama Bear has blood type AB while Papa Bear has type O blood. What are the chances that their…
A: Mama bear has blood type AB. The genotype of Mama bear is i^A i^B. She produces i^A and i^B alleles…
Q: ) Why is Hot Start PCR technique preferred by some researchers?
A: Introduction A modified version of the common polymerase chain reaction (PCR), known as "hot start…
Q: Determine if the cells in telophase II of meiosis are haploid or diploid.
A: Cell division is the process by which the parent cell gets divided into daughter cells. In…
Q: number
A:
Q: Macmillan Learning There are many examples of species that were ancestral to or closely related to…
A: Australopithecus afarensis existed between 3.9 to 2.9 million years ago(mya). So, the first blank…
Q: Why doesn't the blind spot interfere with our normal vision?
A: Our eyes are sense organs for vision. They also help in perception of colour. Human beings have two…
Q: What does maximum assimilation (amax) tell us about the plants photosynthetic rate?
A: Photosynthesis is the process by which plant convert the light energy from the sun to the chemical…
Q: A cortical module found in the visual cortex represents what type of visual information? a. All of…
A: Visual cortex The major cortical area of the brain is where visual information conveyed from the…
Q: How does shaking influence the growth rate of a bacterial culture? Why does it matter?
A: Microorganisms are the tiny organism that cannot be seen as such through naked eyes but requires…
Q: Photosynthesis concept map scaffold organelle where Preactions occur is has membranes called genente…
A: Phototrophs utilize the process of photosynthesis to transform light energy into chemical energy,…
Q: Caenorhabdiris elegant posses motor neurons called MNs. It has been determined that few cells known…
A: Neurons are the fundamental units of the brain and nervous system. These are the cells responsible…
Q: Control of blood flow is primarily mediated by
A: Arterioles, small blood vessels that carry blood away from your heart. They control blood flow…
Q: Why AFM ( Atomic force microscopy) subject to water problem?
A: Please follow steps 2 & 3 for detailed explanation.
Q: Ozana was born with cataracts, which made her completely blind. When she was 14 years-old she…
A: Neuroplasticity, also known as brain plasticity, is the ability of the brain's biological, chemical,…
Q: Factions in our cells happen in a perfect way , therefore DNA replication is error free
A: Ans: DNA replication is defined as the process in which a double stranded DNA molecule is duplicated…
Q: Bryan has albinism, an autosomal recessive trait, which means he is homozygous recessive for…
A: Ans: Albainism is an autosomal recessive disorder. For this disease to develop two copies of an…
Q: Which of the following gene regulatory molecules act in cis. Check all that apply. The lac operator…
A: DNA is the genetic material in living organisms that contain specific sequence of nucleotides. The…
Q: iii,iv ,v
A: i). The protein expression in the pET vector cultured in BL21(DE3). The IPTG induction at specific…
Q: Some initial studies looking at the carcinogenicity of tobacco products took extracts from those…
A: Introduction: When we inhale cigarette smoke, tar, a sticky, brown material, gathers in our lungs.…
Q: Cloning of an eukaryotic gene can be carried out in bacterial cells. However, for the protein…
A: Eukaryotic genes are the regions of DNA that act as templates for the production of RNA by RNA…
Q: Q6.10. For a population containing 70 females and 30 males, what is the effective population size,…
A: Evolution is a steady phenomenon that cause transformation of life form from much simple to more…
Q: he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in…
A: Given: The sequence of the alpha-2 globin of the human hemoglobin gene cluster found in chromosome…
Q: From my point o veiw, this anwer is either A, B, C, D, or E, so where is the answer?
A: An evolutionarily conserved mechanism that is essential for preserving cellular homeostasis is the…
Q: Which of the following gene regulatory molecules act in trans. Check all that apply. The lac…
A: Introduction:- The gene regulatory molecules helps in regulating the expression of different genes,…
Q: II. Cultural characteristics of yeasts. Below is the colony diameter for each yeast culture grown on…
A: Yeasts are single-celled, eukaryotic microorganisms that belong to the fungal kingdom. There are…
Q: Dust explosions can be destructive and deadly, so how can this occur and would how you classify this…
A: The fast burning of minute particles floating in the air within a confined environment is known as a…
Q: 2. How would you determine if the two populations belong to the same species? What factors might…
A: Population is a group of individuals that belong to same species. Species contain organisms that…
Q: What is the major difference in the functions performed by the conventional PCR and real time PCR?…
A: PCR REAL TIME PCR A technique to amplify a segment of DNA , generating millions of copies of a DNA…
Q: Use the survivorship curves (A, B, and C) shown on the graph below to answer the following three…
A:
Q: Consider the image below. This image shows plasmid DNA isolated through exactly the same method that…
A: Removing RNA is one of the crucial processes in plasmid purification, especially after the manual…
Q: During PCR, the reaction mixture cycles through three temperatures (for example 94, 60, and 72…
A: Introduction : Using the thermo-resistant DNA polymerase, the polymerase chain reaction, also known…
Q: Acetylcholine is a neurotransmitter that, when bound to its receptor, causes the receptor to open a…
A:
Q: Gene cloning is a process in which a gene of interest is identified and made into multiple copies.…
A: Gene cloning is the process that includes the isolation of a specific gene or DNA sequence and then…
Q: missing a name or two from the list (Enterobacter aerogenes), and (Serratia rubidaea) - should be 20…
A: Bacteria are identified using various biochemical tests and standing techniques. The best example is…
Q: Do environmental stochasticity and demographic stochasticity impact small populations or large…
A: The difference between the actual number of people and the number predicted based on average vital…
Q: If the primers you purchased possessed the following information. 5'-GGA AAC AGC TAT GAC CAT G-3'…
A: Introduction :- All living things require primers, which are brief, single-stranded nucleic acids,…
Q: What patterns do you detect? Often in disease outbreak investigations we want to see a pattern for a…
A: Disease outbreaks, or the appearance of more cases than anticipated, happen regularly. Health…
Q: Which of the following components found in the bone matrix make bone somewhat flexible and…
A:
Q: Considering the anatomy of reptiles and amphibians explain the difference between these two 2…
A: Reptiles and amphibians are the important organisms under the animal kingdom. They are tetrapods…
Q: OLIVE 00:52:48 assify the following characteristics to distinguish between active and passive…
A: In humans, immunity is divided into two types; active and passive. There are different processes…
Q: why is the maintenance of homeostasis especially important during development of new umans within…
A: Maintenance of homeostatis is very important in fetuses . The placenta plays a very important role…
Q: Describe the importance of dietary sugars and lipids. In your answer, discuss in detail the impact…
A: Introduction A macromolecule, such as a protein or nucleic acid, is a very big molecule crucial to…
- Can body composition be directly measured? Why or why not?
Step by step
Solved in 3 steps
- Do people with desirable body composition physically fit? why or why not?What is the relationship between BMR and body size? Why?Based on the figure below, how many compartments are being assessed in the tests you selected? Wagner and Heyward - 1999 - Techniques of Body Composition Assessment A Revie.pdf
- • How important is the coordination of body parts and for some parts to act as controller to the success of your existence here on earth as a higher-level animal?On her first anatomy and physiology exam, Heather defined homeostasis as “the condition in which the body approaches room temperature and stays there.” Do you agree with Heather’s definition?How many body parts does a human
- What is the range for body temperature?What type of body shapes are stocky, muscular, sturdy, robust, slim and fat? Like you can you domestic cat as example of the body shape to show Will it look like with those physical descriptionwhat are some of the advantages of knowing human anatomy and physiology?
- Aside from its organization, what are the other characteristics or functions of the human body?How can we use anatomical terminology to describe body partsWhy might you expect the sole area of human feet to scale with body height squared? Why might you expect the sole area of human feet to scale with body height cubed?
