%3D12/15Which question MOST likely may have led to the development of recombinant DNAtechnology?Can human genes beintegrated intobacterial DNA soCanCan DNA be cut intofragments byrestriction enzymesCan human genes beintroduced into theundifferentiatedcells be used toand then separate intounique patterns?bacteria can copy thegenes and producetheir proteins?repair parts of thebody?cells of people withgenetic disorders usinga virus?Music offZoom InSign outO 3:26Lenovo

The biotechnology is considered as the domain that involves usage of technology in the problems of…

Answered: Can DNA be cut into fragments by…

Science

Biology

Can DNA be cut into fragments by restriction enzymes and then separate into unique patterns?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 23QP

See similar textbooks

Related questions

Q: How are Recombinant DNA formed? What is the difference between genetic modification and selective…

A: DNA recombination is a technique by which hybrid DNA is constructed by inserting desired DNA…

Q: How does size of DNA affect size traveled during electrophoresis?

A: Electrophoresis is a technique for the separation followed by the analysis of the macromolecules…

Q: What is the meaning of DNA clone?

A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that coil around…

Q: What happens if DNA polymerase fails to correct an error?

A: DNA is a nucleic acid that serves to store genetic information.

Q: Do most cells contain complete copies of an organism’s DNA? Do most cells express all of the genes…

A: Genome is composed of all the genes present in an organism present in the nucleus. A genome can be…

Q: Once DNA is extracted, what can it be used for?

A: Genetic material is the molecules which should have certain characteristics like it should replicate…

Q: How does a DNA microarray work?

A: Gene microarray technology enables to deposit many different DNA sequences on a small glass slide,…

Q: What is the purpose of genetic transformation?

A: Genetic transformation is a genetic alteration process that involves incorporation and expression of…

Q: How to identify recombinant DNA?

A: When a desired foreign gene or a particular segment of foreign DNA is inserted into the host genome,…

Q: In making recombinant DNA, what is the benefit of using a restriction enzyme that cuts DNA in a…

A: Introduction Enzymes play a key role in biotechnological tools which helps in various invitro…

Q: In the extraction of DNA of Banana, what do the DNA look like?

A: Introduction Bananas are elongated, edible berries produced by several species of big herbaceous…

Q: What are techniques available for Analyzing DNA ?

A: Techniques which are availaible for Analyzing DNA are : By the use of Methylation and Sensitive…

Q: How to analyze recombinant DNA molecules ?

A: Bacterial transformation is a recombinant DNA technology, used for introducing a gene of interest…

Q: What is involved in DNA sequencing?

A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…

Q: What is an advantage of using recombinant DNA to make proteins such as insulin, human growth…

A: Recombinant DNA molecules are DNA molecules formed by laboratory methods of genetic recombination…

Q: What are genomic DNA libraries ?

A: Contains DNA fragments representing entire genome of an organism. Created using molecular cloning.…

Q: What is the role of alcohol in extracting DNA?

A: DNA (Deoxy Ribonucelic Acid) extraction is carried out to perform experiments. The first…

Q: What is the purpose of recombinant DNA?

A: Purpose mentioned below.

Q: What is the principle of DNA isolation?

A: DNA isolation is a process through which the intact DNA of the organisms is extracted and used for…

Q: Distinguish between digesting DNA with restriction enzymes and mechanical shearing of DNA?

A: Known specific sites are digested by the help of the restriction enzyme for the digestion of the…

Q: How could DNA-mediated transformation be used to test chemicals for their mutagenic activity?

A: Deoxyribonucleic acid (DNA) is an inheritable entity of almost every living organism. It is…

Q: Is it biologically advantageous that DNA is stable?

A: DNA (deoxyribonucleic acid) is a double helical twisted ladder-like structure that stores and…

Q: What is recombinant DNA? How can it be used to produce human proteins in bacteria?

A: Recombinant DNA: Recombinant DNA is produced by combining DNA segments that doesn't normally occur…

Q: How is the recombinant DNA cloned or amplified?

A: DNA fragments that contain the sequences of interest can be produced by digestion using restriction…

Q: Can DNA be isolated from beef? Discuss the process briefly

A: The purification of DNA from the collected sample of DNA with the help of the various methods and…

Q: What is Recombinant DNA?

A: Question is about recombinant DNA .

Q: Why is DNA denaturation important?

A: DNA denaturation aka melting is the separation of the double strands of the DNA into 2 individual…

Q: What are the advantages of doing DNA sequencing?

Q: How does salt help in the DNA extraction process?

A: DNA is extracted to compare the DNAs from different sources and to study the sequence differences.…

Q: What is transgenic DNA?

A: Recombinant DNA technology involves integrating DNA molecules from two different species and…

Q: How is DNA amplified in a polymerase chain reaction(PCR) procedure?

A: Step 1 Polymerase chain reaction (PCR) sometimes also called molecular photocopying is a technique…

Q: In this picture of gel electrophoresis of DNA, which sample contains the longest/largest piece of…

A: DNA (Deoxyribonucleic acid) is a double helical structure that consists of nucleotide. Nucleotide…

Q: How is a recombinant DNA molecule generated?

A: Recombinant DNA is known to contain DNA segments from multiple sources and is constructed via…

Q: After a piece of DNA is sequenced, what type of analyses can be performed?

A: After the sequence of the DNA have been found many analysis are performed on the DNA.

Q: How will you obtain purified DNA from a cell?

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: How can specific genes be retrieved from a DNA library?

A: Deoxyribonucleic acid or DNA is a molecule that contains the genetic code of the organisms. DNA…

Q: How is genomic DNA prepared for shotgun sequencing?

A: Genomic DNA prepared for shotgun sequencing as follows : 1. ligating random genomic DNA fragments…

Q: What does PCR allow you to do with DNA?

A: NOTE:- "As you have asked multiple questions under one, we will solve the first part for you, to get…

Q: Do DNA-polymerase enzymes also function as exonucleases?

A: DNA polymerase enzyme is primarily responsible for the synthesis of DNA by the attachment of various…

Q: What is/are the purpose of DNA extraction?

A: DNA is the genetic material present in almost all living cells. The DNA is responsible for various…

Q: What are recombinant DNA molecules?

A: A technique that alters the phenotype of an organism when its genome is integrated with the…

Q: Describe how certain restriction enzymes generate DNA fragments with sticky ends, and others…

A: Restriction enzymes also called molecular scissors are the type of nuclease enzymes that cleaves the…

Q: Restriction enzymes look for palindromic sequences of DNA to cut, how does it recognize those…

A: A restriction enzyme or restriction endonuclease is an enzyme that cleaves/cuts DNA into fragments…

Q: If the GAATTC palindrome is repeated four times on the same piece of linear DNA, and the restriction…

A: The restriction enzymes are responsible for cutting the double stranded DNA molecules at specific…

Q: Do restriction enzymes always cut the DNA at the recognition sequence?

A: Restriction enzymes are a class of enzymes that cut DNA into fragments based upon recognizing a…

Q: What is DNA cloning?

A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that coil around…

Q: How would one recognize a gap in the genome sequence following nucleotide sequencing?

A: DNA is made up of four bases namely adenine (A), thymine (T), cytosine (C), and guanine (G). The…

Q: Why don’t bacteria cut up their own DNA when they produce restriction enzymes?

A: Restriction enzymes are the proteins which can cut double stranded DNA segments only at some…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

100%

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
For each of the restriction enzymes listed below:(i) Approximately how many restriction fragmentswould result from digestion of the human genome(3 × 109bases) with the enzyme? (ii) Estimate theaverage size of the pieces of the human genomeproduced by digestion with the enzyme. (iii) Statewhether the fragments of human DNA produced bydigestion with the given restriction enzyme wouldhave sticky ends with a 5′ overhang, sticky endswith a 3′ overhang, or blunt ends. (iv) If the enzymeproduces sticky ends, would all the overhangs on allthe ends produced on all fragments of the humangenome with that enzyme be identical, or not? (Therecognition sequence on one strand for each enzymeis given in parentheses, with the 5′ end written atthe left. N means any of the four nucleotides; R is any purine—that is, A or G; and Y is any pyrimidine—that is, C or T. ^ marks the site of cleavage.)a. Sau3A (^GATC)b. BamHI (G^GATCC)c. HpaII (C^CGG)d. SphI (GCATG^C)e. NaeI (GCC^GGC)f. BanI (G^GYRCC)g. BstYI…
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
Write out the resulting DNA molecules after the following double stranded DNA molecule is digested with EcoRI: 5’-ATGTTAGAATTCTACGTCGAATTCAAATTT-3’ 3’-TACAATCTTAAGATGCAGCTTAAGTTTAAA-5’
A bacterium has a genome size of 4.4 Mb. If a researchercarries out shotgun DNA sequencing and sequences a totalof 19 Mb, what is the probability that a base will be leftunsequenced? What percentage of the total genome will beleft unsequenced?
You do a PCR reaction,run a sample of the product on a gel,and use a dye to visualize the bands. Youexpect a single product of 300 bp, whichyou observe, but you also see a band ofabout 550 bp. Can you suggest a reasonwhy? Does the size of the unexpectedband indicate anything about your targetsequence?
An alien organism was investigated. When DNA replicationwas studied, a unique feature was apparent: NoOkazaki fragments were observed. Create a model of DNAthat is consistent with this observation.
On further analysis of the DNA described in conceptual questionC21, you discover that the triplex DNA in this alien organism iscomposed of a double helix with a third strand wound within themajor groove (just like the DNA in Figure shown). How would youpropose that this DNA is able to replicate itself? In your answer,be specific about the base-pairing rules within the double helixand which part of the triplex DNA would be replicated first.
Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
During electrophoresis, DNA molecules can easily be separatedaccording to size because all DNA molecules have the samecharge–mass ratio and the same shape (long rod). Would youexpect RNA molecules to behave in the same manner as DNAduring electrophoresis? Why or why not?
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH