Can SARS CoV 2 be transmitted via milk? Support your answer.

Q: Question 3. Which of the following dictates the number of trophic levels or feeding levels? a.…

A: Food chain is basically the transfer of energy from one organism to other in an ecosystem  Types of…

Q: Central African chimpanzees (Pan troglodytes troglodytes) and bonobos (Pan paniscus) are two…

A: The events that are responsible for the evolution of species from the ancestral population is called…

Q: Predict what might happen if microorganisms began releasing methane. How will this affect the…

A: A greenhouse gas is a gas that ingests and radiates energy inside the thermal infrared range,…

Q: GC-MS can be used to separate and identify proteins, and HPLC is commonly used to separate lipids…

A: GC-MS can be used to separate and identify proteins, and HPLC is commonly used to separate lipids it…

Q: Your short answer should be 2-5 sentences depending on the question. (Ch. 53). Please answer both…

A: The growth curve is an important part of a population which indicates the stability and…

Q: When a neurotransmitter-filled vesicle is in the primed position, which t-SNARE connect is critical…

A: Synapses are structures or junctions that facilitate the passing of an electrical or a chemical…

Q: DO NOT COPY IN GOOGLE OR BARTLEBY QUESTION: Why is there a need for replica plating? How is…

A: Replica plating is technique related to microbiology. In replica plating colonies inoculated into…

Q: What is the significance of the behavior of the vectors that allow La Crosse encephalitis to persist…

A: La Crosse encephalitis is a viral illness that is caused by mosquitoes. This illness is transmitted…

Q: How is it not The anterior cerebral artery?

A: Anterior cerebral artery is The anterior cerebral artery (ACA) is one of two cerebral arteries( the…

Q: In flies, long wings (W) are dominant to short wings (w). Two homozygous recessive are crossed.

A: Genetic inheritance is the process of transfer of gene from the parent to progeny  Factor affecting…

Q: Having a prenegotiation meeting in the Mushroom simulation is a form of Oe) Authority power O a)…

A: ANSWER) Intra-organizational bargaining is the meeting held within the organisation by considering…

Q: Targeted metagenomics is helping researchers better understand the complex connectios between diet,…

A: As we can see in the pie charts that Bacteriodetes make 35.44% in patients without cekiac disease…

Q: Discuss various alternative treatment methods to overcome drug resistance

A: Drug resistance is a condition in which the effectiveness or therapeutic effect of the drug…

Q: Genomic DNA was isolated from three individuals shown in the pedigree above. Primers were used to…

A: Pedigree charts are used for analyzing the inheritance of certain characters within a family. They…

Q: Are humans different on a species level? only a few somewhat no yes

A: The scientific name of human is: Homo sapiens. It belongs to Mammalia class in chordates. The human…

Q: Animals: -coordinate muscle movement using their nervous systems. -rely on cell walls for support.…

A: Not all animals possess nervous systems,  (example: porifera) therefore option 1 is incorrect.…

Q: How might the asymmetry of an embryo change if after fertilization its moved to a restrictive…

A: The application of temperature-sensitive mutants necessitates changing the temperature of the…

Q: Cytotoxic T Cells attack O pathogens, rapid growth and division O pathogens, apoptosis (cell death)…

A: Introduction Immunity is defined as the ability of the body to fight against the pathogens. There…

Q: What are the behaviors that need to be changed? What health promotion actions would help?

A: ANSWER) As the lady is diagnosed with osteoporosis therefore the most important changes which should…

Q: Choose ALL the events listed below that occur in the cytoplasm of eukaryotes. Select one or more: a.…

A: In eukaryotic cell, translation process occurs in cytoplasm. Translation is the process, that…

Q: Coronavirus background and origin

A: Background of coronavirus. COVID-19 is caused by a virus called SARS-CoV-2. It is a member of the…

Q: 1. You are a lead engineer in a cGMP facility that develops and delivers tissue engineering…

A: Globally, myocardial infarction (MI) is one of the leading causes of death. Loss of cardiomyocytes,…

Q: Hybridization can occur between DNA and RNA B. tRNA transcripts must be cleaved by an endonuclease…

A: Introduction DNA and RNA are genetic material of a cell these are made up of nucleotide. change in…

Q: Identify the parts in these plant and animal cells. Human cheek cell, 400x Outermost layer Animal…

A: Image in left upper corner: As human cheek cell is an animal cell, the organelle that contains DNA…

Q: Mosquitoes and ticks transmit pathogens to mammals. For each vector, explain how the life cycle,…

A: The illnesses brought on by vectors are known as vector borne diseases. A vector, such as a…

Q: 2. Using a reference, find the function of smooth muscle tissue in humans and one would find it.…

A: The hollow body organs like the bladder, colon, and stomach all contain smooth muscles. They are…

Q: State how the distribution of bicoid protein changes after fertilization

A: this question from developmental biology. Bicoid protein is special type of protein which is found…

Q: 1. Why are some microorganisms capable of utilizing certain carbohydrates and some are not?

A: Depending on the unique enzymes of each bacterium, different energy sources are used by bacteria in…

Q: 44. Stress weakens our immune system and increases the likelihood we will experience certain health…

A: Malnutrition, also known as malnourishment, is a situation caused by eating a diet that contains…

Q: State a way in which you could figure out all of the genes involved in forming a trait using…

A: The gene is the sequence of nucleotide bases in DNA. These code for a specific protein or a trait in…

Q: Mitochondrial replication and segregation Transmitted only by the mother Affected organs: muscles…

A: Mitochondria are organelles found in the cells of all eukaryotes. They are often referred to as the…

Q: What is NOT true about the function of RNA polymerase? O its rate of activity is similar for all the…

A: Promoter sites are short DNA sequences found in the promoter region of a gene. They act as binding…

Q: Which of the following statements is false about the impacts of climate change? Choose all that…

A: Increased temperatures, severe weather, ice melt, and rising sea levels are just a few of the…

Q: Summarize the evidence regarding the sum of evolutionariy modifications from the given putative…

A: Evolution is the gradual change in the inherited traits of biological populations over many…

Q: In classical Mendelian genetics, how can one check the genotype of a parent (A) expressing the…

A: Allele can be defined as an alternative form of gene.Dominant allele is an allele which hides the…

Q: natural selection

A: Evolution is change in characteristics of species over several generation and relies on natural…

Q: What phenotypes do you think a homozygous tra1hsn animal with a loss of function Egl-1 mutation…

A: The phenotype is the physical appearance or observable trait of an individual genotype. The…

Q: Put the steps of the process of signal transduction in the order they occur (hint - try to decide…

A: The receptors have site for binding of specific ligand. The receptors are of two types: Membrane…

Q: How do you feel about the fact that you (the general public), as of today, can purchase biohacking…

A: CRISPR kits are gene-editing kits that enable users to experiment with the CRISPR/Cas9 gene editing…

Q: Assume two alleles A1 and A2 with known frequencies e.g. p (A1) = 0.7, q (A2)= 0.3 What would be…

A: There is single gene. It has two alleles: A1 and A2. The allelic frequency of A1: 0.7  The allelic…

Q: Hi! I am interested in getting some help with this question.  This spectacular animal is a Lesser…

A: Our ecosystem provides home and shelter to various birds, butterflies, and other creatures, they…

Q: A population of bats becomes isolated after colonizing an island, developing a high incidence of a…

A: The population is the group of individuals belonging to the same species and able to interbreed.…

Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…

A: Introduction  The process by which a gene's information is used to produce either RNA molecules that…

Q: Can we just insert a gene on an organism? - In plants, the use of Agrobacterium, we're there any…

A: Transfer of genes is a common component of genetic engineering projects, i. e. DNA transfer between…

Q: Snowy owls are large white birds that normally inhabit the cold northern regions of Canada.…

A: 1. As the food web shown in figure is interconnected, many species will be affected by introduction…

Q: Outline the three major mechanisms of cell fate determination in developmental genetics. please…

A: Mechanisms of cell fate determination. Autonomous specification, conditional specification, and…

Q: From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?

A: A codon is made up of three nucleotides. Such codons are abundant in messenger RNA and consist of a…

Q: What is the resultant ionic movement when stereocilia move towards the tallest kinocilium? Efflux of…

A: Introduction :  Around the hair cells of the inner ear are two different kinds of fluid. The fluid…

Q: What are the different anatomical joints used in a block start for a sprint? What is happening at…

A: Sprint athletes brace their feet against starting blocks at the beginning of a race to prevent them…

Q: If the clearance of sodium doubles in a normal person then the following is physiologically likely:…

A: If the clearance  of sodium doubles in a normal person: Doubling of plasma sodium will not occur…