Can you explain which answer is accurate and why it's the correct choice?

Q: Question 6 All of the following are functions of water except? O Acts as a coenzyme in chemical…

A: Water isn't just for quenching your thirst; it's also necessary for keeping your body running…

Q: How can you protect yourself from diseases that can be acquired from the environment?

A: 1)Good hygiene: the most important way to prevent infectionsThe first line of defense is the control…

Q: Assume for a moment that crossing-over did not occur. Would you agree that you received half of your…

A: Crossing over is a phenomenon that develops in novel gene combinations by transferring and swapping…

Q: In cattle, the gene for hornless (H0 is dominant to the gene for homed h), the gene for black (8) is…

A: Given: In cattle, Gene for hornless (H) is dominant to the gene for horned (h). The gene for black…

Q: Distinguished between open and closed circulatory system, and discuss their effectiveness in…

A: All multicellular animals need a circulatory framework to transport oxygen and supplements through…

Q: 4. WATER HAS THE PROPERTY OF ADHESION, WHICH ALLOWS IT TO USE WHICH PROCESS IN PLANT ROOTS? A:…

A: Ans is.. capillary action

Q: in certain fish the mating of black-scaled (B) with white a white-scaled (W)  will create offspring…

A: Introduction :- Fish are aquatic vertebrate animals having gills but no digits on their limbs, such…

Q: 2. Why do we use samples in the collection of data?

A: Introduction Scientific data:- It is defined as information collected using particular methods for a…

Q: To examine: Whether the statement "protein tyrosine phosphatases display exquisite specificity for…

A: Protein tyrosine phosphatases shows exquisite specificity for their substrates.

Q: Compare and contrast the views of animal evolution based on body plan characteristics to those based…

A: When the anatomical or physical traits are considered for the determination of evolution then the…

Q: how will the body maintain homeostasis in osmoregulation

A: Homeostasis refers to an animal's capacity to manage different physiological cycles to keep the…

Q: What is the principle behind a UV-Vis spectrophotometer, and what are its key components, and how…

A: UV-vis spectrophotometry or UV spectroscopy types of absorption spectroscopy or reflectance…

Q: What is the type of the following variable? double num 12.345; %3D char int string double

A: The type of data contained in a variable is indicated by its data type.

Q: What are some theories or causes of narcolepsy along with the the treatment or therapeutic methods…

A: Narcolepsy is derived from the greek words "narco," that means numbness, or stiffness, and "lepsy,"…

Q: 19. Which of the following is true about cardiac muscle? A. It is voluntary and striated B. It is…

A: Muscles These are soft tissues. There are three types of muscles in human body. These are: Smooth…

Q: Can you determine if a plant is a monocot or dicot just by looking at the pattern of the roots? The…

A: Introduction In vascular plants, a vascular bundle is a constituent of the transport system. The…

Q: Are humans a land-sharer Or land-sparer? Why?

A: Land-sharing systems and Land-sparing systems are two contrasting approaches to sustainable living.

Q: This question follows from the last question The D value for a resistant strain of bacterial spores…

A: There are general points that should be kept in mind : as we know that bacterial growth is an…

Q: Fermentation is a strategy used by cells to a. oxidize NADH. b. reduce рyruvate. increase 02 levels.…

A: Introduction :- Fermentation is a metabolic process that uses enzymes to cause chemical changes in…

Q: A patient is admitted to the surgery ward for an appendectomy. Describe the layers of muscles the…

A: The appendix is a small finger-shaped organ that is located beneath the right abdomen. It has no…

Q: 4. Give at least 2 major contributions of Cambrian explosion to evolution

A: 4. The Cambrian Period is significant in the evolution of life on Earth since it is when most of the…

Q: giving examples to illustrate your answer define both selective media and enrichment media as might…

A: Every microbiologist must eventually grow bacteria in the lab for research purposes. Bacterial…

Q: II. Problem Solving: Instruction: Using the data on the situation below, compute for the…

A: We are only allowed to do upto three subpart of a question. Please repost the undone question again.…

Q: if you had penicillin leftover from a previous sore throat can you use it for a leg cut. explain…

A: Kids or adults who are allergic to penicillin may    be able to take one of these antibiotic instead…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: The process of synthesis of proteins from mRNA is called as translation while the process of…

Q: Animal Diversity Second mouth Symmetrical animals Asymmetrical animals Spiny skin Radial symmetry…

A: These are term related to animal diversity.

Q: Two pea plants with the following genotypes are cross fertillized. RrSsTtVv X RrssTTVv calculate the…

A: A genotype is an individual's gene collection. A genotype is defined as a person's collection of…

Q: i need the answer quickly

A: Dust is of following types: - Visible Microscopic Ultra Microscopic Visible is filtered out at the…

Q: In which of the following situations would you expect to probably see differences in the speed of…

A: Molecular clock  It is a measure of evolutionary change over time.

Q: 4. Give at least 2 major contributions of Cambrian explosion to evolution. 5. Define human…

A: Human evolutionary genetics investigates how one human genome differs from another, as well as the…

Q: PAMPS, TLRs, interferon

A: Human immunodeficiency virus (HIV) is a virus which attacks the human (body's) immune system.   it…

Q: A compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is…

A: The total set of nucleic acid sequences encoded as DNA within the 23 chromosomes is known as the…

Q: To explain: The Pasteur effect on the aerobic culture of yeast on glucose, where the rate of glucose…

A: Introduction The Pasteur effect:- It is an inhibiting effect of oxygen on the fermentation process,…

Q: What does the negative of the Methyl Red for the Enterobacter aerogenes to do

A: The methyl red (MR) test identifies the formation of enough acid during glucose fermentation and the…

Q: please put (+) if the feature is present and (-) if not. kindly give a short explanation also on the…

A: The pith and cortex of a monocot stem are not separate, whereas the cortex and pith of a dicot stem…

Q: Whale 100,000 calories 200 kilocalories (kcal) Krill 1,000,000 calories 80 kcal Cellular respiration…

A: The plants and animals produce the organic material which is renewable and it is known as the living…

Q: ROSE OF WIND 1. graphic image of the frequency of wind direction in the area 2. wind speed, shown…

A: A wind rose is a graphical tool that meteorologists employ to show how wind speed and direction are…

Q: How does natural increase, natural decrease, equilibrium affects or influence the population and…

A: Typically, population refers to the number of people in a certain place, such as a city or town,…

Q: What are the importance tof ants o other organisms and to the environment

A: The ant is one of the world's most strongest animals comparable to its size. A single ant can carry…

Q: DEVICE FOR EVALUATING VALUES (KEO) - THE NATURAL LIGHTING COEFFICIENT 1 Krotov's apparatus. 2.…

A: Daylight factor It is the ratio of horizontal indoor to exterior daylight illumination. Represented…

Q: cance of color blindness in humans is due to a recessive gene located on the X chromosome X linked).…

A: Mother     ×      father            XXc                  XcY Progeny -      X Xc Xc XXc…

Q: How does Red Queen Hypothesis cause an evolutionary race with coronaviruses and mammalian species

A: RED QUEEN HYPOTHESIS - The Red Queen hypothesis was coined in evolutionary biology to explain that a…

Q: I. lipase II. hydrochloric acid III. pepsinogen A. I only В. I only C. I and II only D. II and III…

A: Gastric juice is secreted by the stomach wall when stimulated by the hormone gastrin. When initially…

Q: The needed to raise one gram of water one degree celsius is called a calorie. A. kilocalories B.…

A:

Q: QUESTIONS FOR RESEARCH AND PROBLEMS 1. Give the major factors that cause changes in the genotype and…

A: The complete set of genetic material in an organism is known as genotype. It can also be referred to…

Q: explain why there are more similarities between humans and chimpanees than between human and dogs.

A: Monkeys, chimpanzees, and humans are primate groups. Primates are vertebrates that are portrayed by…

Q: 7. A nail driven into the side of a tree will remain at exactly the same distance from the ground…

A: Angiosperms: Flowering plants, also known as angiosperms, are plants that produce flowers and…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A: DNA  contains the genetic information about the characteristics features of te organism present in…

Q: a catabolic process.

A:

Q: Question 4 (1 point) Metabolism refers to burning food during physical activity like running.…

A: The true answer is... All of these (e)

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.