A compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is stored as a binary code—that is, every bit is either a 0 or a 1. how many bits would it take to specify each nucleotide pair in a DNA sequence? how many CDs would it take to store the information contained in the human genome?

A compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is stored as a binary code—that is, every bit is either a 0 or a 1. how many bits would it take to specify each nucleotide pair in a DNA sequence? how many CDs would it take to store the information contained in the human genome?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

How many nucleotides does the human genome contain?
By average, how many Sau3A (5’GATC3’) sites are there in a 10 kd DNA molecule? (1/4)^6 * 10,000 = 2.44140625 => 2.4 For the above 10 kb DNA, if you use Sau3A to do a complete digestion, you will only get a lot of small fragments ( 200~500 base pairs). What should I do if I want to get larger digested fragments (say 3 to 5 kb) Please answer asap and type your answer and do not copy from anywhere please
What would be the percentage of G, C, A, and T in each column? Have to calculate the nucleotide frequency from my sequence.
A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?
If DNA concentration is 2 grams, what would be the molar concentration of human DNA in a human cell?
You have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100 percent identical to a protein in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical. How would you interpret the observations? Please make sure to select ALL correct answer options. Because genetic code is redundant, changes in the DNA nucleotide sequence can occur without change to its encoded protein. Due to the flexibility in the third positions of most codons, the DNA sequence can accumulate changes without affecting protein structure. Natural selection will eliminate many deleterious amino acid changes. This will reduce the rate of change in the amino acid sequence and lead to sequence conservation of the proteins. Protein sequences are expected to evolve and…
In computer science, a bit stores one of two states, 0 or1. A byte is a group of 8 bits that has 28 = 256 possiblestates. Modern computer files are often megabytes(106 bytes) or even gigabytes (109 bytes) in size. The human genome is approximately 3 billion base pairs insize. How many nucleotides are needed to encode asingle byte? How large of a computer file would it taketo store the same amount of information as a single human genome?
Let’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…
. While studying the structure of a small gene that was recently sequenced during the Human Genome Project, an investigator notices that one strand of the DNA molecule contains the following: 20 adenine (A) bases 30 cytosine (C) bases25 guanine (G) bases 22 thymine (T) bases How many of each base is found in the complete double-stranded molecule?
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?
The average of a number of closely related but nonidentical sequences is referred to as a(n) _____________.