Cell growth and division occurin a regular cycle. This cycle is divided into four phases: G1, S, G2, andM. The diagram sh ows this cycle, alongwith events that occur in each phase. Follow the promptsbelow.v Color the phase in which most cell growth occursBLUEv Color the phase in which DNA replication occurs RED.v Color the phase in which preparation for mitosisG2occurs in YELLOW.v Color the phase in which mitosis and cytokinesisoccur in GREEN.4. Which three phases make upinterphase?GIM5. Which of the following best describes cancer? Circle thecorrect answer.uncontrolled cell growthcells stop growing6. If a dog has 72 chromosomes in a SOMATIC cell, howmany chromosomes will its daughter cells have aftermeiosis_?mitosis_?P.

Most growth: Blue: Interphase DNA Replication: Red : S phase Preparation of Mitosis : Yellow: G2

Cell growth and division occurin a regular cycle. This cycle is divided into four phases: G1, S, G2, and M. The diagram shows this cycle, along with events that occur in each phase. Follow the prompts below. v Color the phase in which most cell growth occurs BLUE v Color the phase in which DNA replication occurs RED. v Color the phase in which preparation for mitosis occurs in YELLOW. v Color the phase in which mitosis and cytokinesis Occur in GREEN. G2

Cell growth and division occurin a regular cycle. This cycle is divided into four phases: G1, S, G2, and M. The diagram shows this cycle, along with events that occur in each phase. Follow the prompts below. v Color the phase in which most cell growth occurs BLUE v Color the phase in which DNA replication occurs RED. v Color the phase in which preparation for mitosis occurs in YELLOW. v Color the phase in which mitosis and cytokinesis Occur in GREEN. G2

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 19P: Figure 28.11 depicts the eukaryotic cell cycle. Many cell types â€œexitâ€� the cell cycle and...

See similar textbooks

Similar questions

Match the items. a. Duplicated chromosomes are seperated into two identical nuclei. b. The cell grows, and prepares for division c. DNA replication occurs. d. Division of the cytoplasm to form two daughter cells. e. The cell grows, and performs other cellular functions (such as making proteins) 1. G1 a b c d e 2. G2 a b c d e 3. Synthesis a b c d e 4. Mitotic phase a b c d e 5. Cytokinesis a b c d e
Match the process with the correct phase of the cell cycle (G1, S, G2, M). If the process occurs in M phase indicate subphase (ex. telophase). E) ___________________Extra cell membrane is synthesized by the smooth ER. F) ___________________DNA is compacted into chromatin.
Amount of DNA per nucleus over the cell division cycle. At which point in the accompanying figure does MPF reach its highest activity during the cell division cycle? a) I b) II c) III d) IV
What is the order in which the following events occur during cell division: A. anaphase B. metaphase C. prometaphaseD. telophase E. lunar phaseF. mitosis G. prophaseWhere does cytokinesis fit in?
Morphology of Chromosomes can bebest studied at ______A. Interphase B. ProphseC. Metaphase D. Zygotene
1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT
Chromothripsis is a rare phenomenon, first discoveredin cancer cells, where a single chromosome “shatters”into many fragments and is reassembled in a rearrangedform by the DNA repair machinery. (The underlyingmechanism causing the shattering is not understood.)Approximately 2% of cancers contain cells with ashattered chromosome. Explain how chromothripsiscould contribute to cancer.
Indicate the stage of mitosis (interphase = I, prophase = P, metaphase = M, anaphase = A, telophase = T) during which each of the following events occur. chromatid doublets separate to individual chromosomescentriole replicatesreplicated chromosomes (chromatid doublets) are arranged in single file next to one another at the cell's equatornuclear membrane is disappearingspindle fibers form and become visiblecell plate (plant) or cleavage furrow (animal) forms and is visiblechromosomes are at opposite poles of the cell; cytokinesis is almost completedchromosomes (chromatids) first become visible as long thin strandsDNA (chromosome) replication occurs
In which phase of the cell cycle does DNA replication occur? a. G1 Phase b. S and M Phases c. S Phase d. M Phase e. G2 Phase
When studying living cells in a laboratory, researchers sometimesuse drugs as a way to cause cells to remain in a particular phaseof the cell cycle. For example, aphidicolin inhibits DNA synthesisin eukaryotic cells and causes them to remain in the G1 phasebecause they cannot replicate their DNA. In what phase of thecell cycle—G1, S, G2, prophase, metaphase, anaphase, or telophase—would you expect somatic cells to stay if the followingtypes of drug were added?A. A drug that inhibits microtubule formationB. A drug that allows microtubules to form but prevents themfrom shorteningC. A drug that inhibits cytokinesisD. A drug that prevents chromosomal condensation
Telophase in Mitosis a ) Chromosomes begin to uncoil into chromatin. b) Nucleolus and nuclear membrane begin to reappear. c) Spindle slowly dissolves. d) In animal cells, cytokinesis occurs with a cleavage furrow dividing one cell into two cells. e) In plant cells, cytokinesis occurs with the formation of a cell plate. This plate divides the original cell into two cells and is part of the new cell wall.
During the cell cycle, overlapping inter-polar microtubules begin elongation during __________, whilechromosome separation commences during __________. A. Metaphase, anaphase B.B. Metaphase, anaphase A.C. Anaphase A, anaphase B.D. Anaphase B, metaphase.E. Anaphase B, anaphase A.