It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT

Q: 2. a) In the diagram of DNA below (Figure 4), a DNA strandis unwinding and new strands of DNA are…

A: The unwinding of DNA helix takes place with the help of enzyme DNA helicase. Addition of nucleotides…

Q: 1. Your colleague is running an experiment on cell cycle. He grows cells in three conditions:…

A: In the cell cycle, interphase is the longest phase of the cell cycle. It has various stages like Go,…

Q: It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of…

A: During the synthesis phase (S-phase) of cell cycle the DNA replication occurs. DNA replication is…

Q: 1) Scientists isolate cells in various phases of the cell cycle. They isolate a group of cells that…

A: "Since you have asked multiple questions, according to our guidelines we are eligible to answer only…

Q: 4) where in the cell they occur, 2) one important protein (or protein containing complex) involved…

A: DNA Replication: Where : Nucleus Protein : Pre-replication complex (ORC1-6, Cdc6, Cdt 1 and MCM2-7…

Q: 6. Complete the cellular detail for each phase as you observe it in the whitefish cells. Below each…

A: According to our guideline we can answer only the first question. So, I did the question number 6…

Q: Which one explains the form of genetic material before nuclear division? a) Euchromatin b)…

A: Nucleus is the control center of the cell. It is a large organelle consisting of nuclear envelope,…

Q: 6. Use the diagram below to answer the following questions. A. The diagram above represents В.…

A: Deoxyribonucleic acid(DNA) is considered to be the genetic material within the nucleus that gets…

Q: If  I extract a cell culture with 100 cells that just entered g1.  I needs to extract the MOST…

A: Introduction: Cell cycle is the process by which a cell replicates i.e. makes copies of itself or…

Q: 1. Let's imagine what would happen to the amount of DNA material in a cell if, when it reproduced,…

A: * During mitosis there are the following phases  G1 phase S phase G2 phase M phase * During G1…

Q: 19.The image below is an Allium root tip under the microscope. Which statement describes what is…

A: Mitosis is a cell division process where a cell divides into two daughter cells that are genetically…

Q: 3. The diagram below shows a DNA replication bubble in a salmon cell. The circles indicate the…

A: Q.The diagram below shows a DNA replication bubble in a salmon cell. Do the circles indicate the…

Q: 4 What does chromatin look like (Hint: This is the form DNA is in BEFORE mitosis) 1 Show Your Work

A: During cell division, chromatin often exhibits changes in shape and compaction and the undergoes…

Q: What cell organelle of the strawberry was broken when it was crushed? a. Vacuole b. Nucleus c. Cell…

A: You have asked multiple questions.  I will answer the first question,  as allowed by guidelines.…

Q: 1.In which phase of the cell cycle are DNA mutations most likely to occur? A.S Phase B.G1 Phase…

A: Mutation - Mutation is defined as the sudden inheritable changes which occurs either in the…

Q: Which of the choices below puts the following events of mitosis into the correct sequence? A.…

A: Cell division is the process by which a mother cell divides into two or more daughter cells,…

Q: 2. What is not true about Human Genome project? Determination of the gene location on the…

A: The Human Genome Project (HGP) was one of the incredible accomplishments of investigation ever.…

Q: What does a chromosome look like? (Hint: This is the form DNA is in AFTER mitosis) 1 Show Your Work…

A: Chromosome - the thread like structure present in nucleus is called chormosome. Chromatin - it is…

Q: Suppose, a group of scientists developed a recombinant enzyme having mutations in its active site.…

A: The active site is a groove or pocket formed by the folding pattern of the enzyme. Catalysis takes…

Q: the time a cell has reached the end of prophase, all of the following have occurred EXCEPT -  a…

A: The cell cycle is the series of cyclic events that takes place to cause cell division. There are two…

Q: 3. What might happen to a cell whose DNA is destroyed? What might happen to a cell whose DNA is…

A: Cell whose DNA is damaged- Every cell in our body's DNA is continually at risk of being damaged.…

Q: 2. The four phases of the cell cycle, in order, are are G,, S, G,, and M. A cell contains the most…

A: The cell cycle is composed of interphase (G₁, S, and G₂ phases), followed by the mitotic phase…

Q: limit" of cell divisions. Telomerase enzymes allow cells to exceed (go beyond) the " 0 a. Mueller 11…

A: Cell division is a process of a parent cell replicating it chromosomal content and dividing itself…

Q: 13. How would living things differ if cell division took place only for reproduction? O A. All…

A: Reproduction is the process of production of progeny. It is of two types -  Asexual Sexual *Only…

Q: . In animals, cytokinesis occurs in which of the following phases of mitosis? a. Telophase b.…

A: Introduction: Cytokinesis is the literal division of a cell, which occurs in both mitosis and…

Q: Complete the following for a cell that contains 6 chromosomes in early interphase (before…

A: Interphase is a metabolically active stage between two mitotic division during which the cell repair…

Q: fAvery, MacLeod, and McCarty had determined that the transforming molecule was RNA, what…

A: In the history of DNA it is found that biologists were trying to identify the genetic material and…

Q: When does DNA replication occur in the cell cycle? Replicate this strand of DNA: ATTCGC TAG…

A: The cell cycle is a sequence of events before cell division occurs, it prepares cells for division.…

Q: Small extrachromosomal rings of DNA, often contain genes that give bacterial cells genetic…

A: Bacteria are the prokaryotic organisms that are placed in the kingdom monera. These organisms do not…

Q: 1. What is happening here? 2. What is the product? Nontemplate strand Polymerase Ribonucleotide…

A: DNA, RNA, and proteins are crucial for performing cellular functions. DNA act as a template and RNA…

Q: Which of the following terms should not be used to describe aBarr body?A. ChromatinB. EuchromatinC.…

A: Barr body or sex chromatin body is one of the two inactive X-chromosomes in mammalian female cells.…

Q: 5. If dividing cells are grown in a culture medium containing radioactive thymidine, the thymidine…

A: In case of eukaryotic organism, cell containing nucleus, the cell cycle is categorized into two two…

Q: When replication happens, how much of cell’s DNA will be replicated? Select one: a. All of it – all…

A: DNA replication is the biological process in which two identical DNA are produced from one original…

Q: (LT#2) . DNA is coiled & condensed into chromosomes so it can A. be packed into a small, organized…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: E.coli phage T4 DNA is terminally redundant and ____________________. A.    linearly permuted B.…

A: 1. The correct answer is option B- circularly permuted.  E.coli phage T4 DNA is terminally redundant…

Q: 1) The activity of the cell cycle is controlled by the abundance of:  A) protein ligases and…

A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading…

Q: 2. Consider the following DNA molecule. Assume this is the DNA sequence of the entire chromosomes.…

A: Answer 1: - tta atc gtc tac gta cta cgt taa tga tcg tac att cat  L     I    V    Y   V     L    R…

Q: 8. Which is NOT TRUE of the S phase? A. DNA undergoes semiconservative replication. B. Identical…

A:

Q: 2n (2n 1. Let's imagine what would happen to the amount of DNA material in a cell if, when it…

A: Mitosis is the process in which any given cell divides into two equal daughter cells with the same…

Q: Two diplold cells DNA replication Mitosis Figure 1 Gernaing Nles Eye Huds Bods Alventious Root bols…

A: Cells are microscopic and they vary in size. The animals made up of single cells are unicellular…

Q: 4) What is occurring during the Anaphase stage of mitosis, such as is shown in the figure to the…

A: Mitosis is also known as equational division. It is divided into following stages -  Prophase…

Q: 4. Name the phase of the cell cycle each of the labeled cells is likely in. A B F D E Copyrighe 2008…

A: Cell cycle or cell division refers to the series of events that take place in a cell leading to its…

Q: What happens to a cell with damaged DNA?   a)  The cell is destroyed.   b)  It leaves the cell…

A: A cell can be defined as the smallest unit which consists of the cell membrane, nucleus, cytoplasm,…

Q: 4.Consider a cell in metaphase compared to a cell in rest (not in the cell cycle leading to cell…

A: Metaphase refers to the second stage of mitosis in the cell cycle of eukaryotes. It accounts for…

Q: 4. Which statement about telomeres is incorrect? A) Telomeres are repetitive nucleotide sequences at…

A: A telomere constitutes end of a chromosome. Telomeres are made of repetitive sequence of non-coding…

Q: 2. Which of the following describes what happens during the cell cycle? Interphase is when the…

A: The cell cycle is the sequence of events that take place in a cell leading to its division and…

Q: 1. Describe the cell cycle. Why do cells divide? Why are the resulting daughter cells from Mitosis…

A: The cell is the structural and functional unit of the body. The cells generally divide to form new…

Q: xamine the graph showing the relative percentage normal and cancer cells spend in various stages of…

A: Cancer cells do not have the property of contact inhibition. Hence they divide in an uncontrolled…

Q: Draw and Describe the DNA of prokaryotic and eukaryotic cells. Give their differences.

A: Genetic is the branch of science that deals with genetic material like genome, genes, DNA, and…