ut (below the strand) the complimentary bases that 2a. The following is a single side of a strand of DNA. Write o would form a DNA strand that would bind to this one. ATG AAA CGC CCA CCA CCA TTT GAA GTT GCA C ThC 11t GCG GET G6T GOT AAA CTT CAA CGT GTA GGG TAG 2b. Now write the complimentary mRNA strand for the original typed strand in 2a. 2c. Write the complimentary tRNA strand for the strand you wrote in 2b. 2d. Using your tRNA strand in 2c, write (abbreviation is fine) the amino acids for each codon. Also state what these amino acid chains become. 2e. Show one or two mutations by writing the complimentary mRNA strand for the original typed DNA strand and like above do the complimentary tRNA, and the amino acids. (repeating 2b & 2c with added mutations) [mRNA] [tRNA] [am acds] 2f. Compared to 2d, did your mutation(s) change an amino acid, change the number of amino acids, or do nothing? Note where your mutation(s) is/are. they occur in gametes) 2g. How do mutations effect the final protein in organisms? (specifically when

ut (below the strand) the complimentary bases that 2a. The following is a single side of a strand of DNA. Write o would form a DNA strand that would bind to this one. ATG AAA CGC CCA CCA CCA TTT GAA GTT GCA C ThC 11t GCG GET G6T GOT AAA CTT CAA CGT GTA GGG TAG 2b. Now write the complimentary mRNA strand for the original typed strand in 2a. 2c. Write the complimentary tRNA strand for the strand you wrote in 2b. 2d. Using your tRNA strand in 2c, write (abbreviation is fine) the amino acids for each codon. Also state what these amino acid chains become. 2e. Show one or two mutations by writing the complimentary mRNA strand for the original typed DNA strand and like above do the complimentary tRNA, and the amino acids. (repeating 2b & 2c with added mutations) [mRNA] [tRNA] [am acds] 2f. Compared to 2d, did your mutation(s) change an amino acid, change the number of amino acids, or do nothing? Note where your mutation(s) is/are. they occur in gametes) 2g. How do mutations effect the final protein in organisms? (specifically when

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 8QP: The following segment of DNA codes for a protein. The uppercase letters represent exons. The...

See similar textbooks

Similar questions

The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
A Section of a GeneAAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: mRNA codons tRNA anticodons amino acids The section of a gene shown above (AAG ATA CAG GCT CGG TAA) is called the Answer (template or non-template) strand. It is also known as the Answer (sense or antisense) strand. The amino acids are determined from the Answer (DNA or mRNA or tRNA) strand
Writing a Full Strand:1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT Complementary DNA:_______________________________________________________________________ B. Make identical strands of DNA CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT (original) ______________________________________________________________________ (new) _____________________________________________________________________ (new) ______________________________________________________________________ (complementary from 1A)2. A. Original DNA: CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT Complementary DNA: _______________________________________________________________________ B. Make identical strands of DNA CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT (original) _______________________________________________________________________ (new) ________________________________________________________________________ (new)…
A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the nucleotide sequence in the complementary DNA strand and then (b) the sequence transcribed from the template strand in mRNA DNA information strand: 5’ AAC GTT CAA ACT GTC 3’
Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop. DNA--> CCT CTT TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA --> protein-->
Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNA
You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’
Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 1. In this given DNA, the top strand is the 5' to 3' strand and the bottom strand is the 3' to 5' strand. The bottom strand (3' to 5' strand) acts as the template for transcription. PLEASE EXPLAIN WHY. 2. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript. 3. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. please answer the 3 questions, thank you so much!