Answered: Chemolithrophs near hydrothermal vents…

Chemolithrophs near hydrothermal vents support a variety of other life forms there. Explain now their role is analogous to that of photosynthetic organisms in the terrestrial environment.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter13: Early Life Forms And The Viruses

Section: Chapter Questions

Problem 4CT

See similar textbooks

Related questions

Q: 2 What is the pathophysiology of trauma?

A: Trauma, in the context of medicine, refers to physical injuries or wounds caused by external forces.…

Q: rown atrophy H&E staining Mark the corresponding elements in the picture: 1 - liver beams 2 -…

A: The liver can be susceptible to various pathological conditions that cause atrophy. One such…

Q: 1. UV light damages DNA by the formation of pyrimidine dimers. Draw the detailed chemical structure…

A: Sometimes there are many accidental lesions formation occurs in DNA, These lesions are temporary…

Q: The diagram depicts the molecular structure of DNA. Label the diagram with the names of the…

A: Purines: adenine, guanine,Pyrimidines: cytosine, thymine, uracil.Nitrogenous base pairs with…

Q: Provide details and explain "Epidemic of Absence by Moises Velasquez Manoff microbiome on the gut…

A: Moises Velasquez-Manoff is the author of the book "Epidemic of Absence: A New Way of Understanding…

Q: DNA Typing U S₁ S₂ Locus 1 U S₁ S₂ U S₁ S₂ Locus 1 Locus 2 U S₁ S₂ U S₁ S₂ Locus 2 Locus 3 1. In…

A: A forensic method referred to as DNA typing, commonly referred to as DNA profiling or DNA…

Q: A pure breeding purple flower is crossed (mated) to a pure breeding white flower. The F1 offspring…

A: Incomplete dominance occurs when both alleles of a gene are only partially expressed at a location.…

Q: Question 17 If a species has 42 pairs of chromosomes, which value represents the number of…

A: A chromosome is a long, thread-like structure found in the nucleus of a eukaryotic cell. It carries…

Q: Define half velocity constant. What is its significance in terms of substrate consumption? In other…

A: In enzymology, the idea of the half-velocity constant, frequently abbreviated as Km, is crucial. It…

Q: Imagine you are a college student volunteering for a nonprofit cancer organization that houses…

A: Cancer is a condition characterized by uncontrolled cell growth and division in the body. These…

Q: draw the mechanism for step 3 of the citric acid cycle.?

A: Citric acid cycle is the second step of aerobic cellular respiration. It occurs in mitochondrial…

Q: PROBLEM 3 4. Show the Punnett square for the cross of a homozygous red eyed female and a white eyed…

A: Drosophila flies exhibit the XX and XY type of sex-determination. In this type of sex determination,…

Q: Which of the following statements is false concerning the motor protein families of kinesins and…

A: Kinesins and dyneins are molecular motor proteins responsible for intracellular transport in cells.…

Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…

A: Fungi are a group of microorganisms that belong to the kingdom Fungi. They are eukaryotic organisms,…

Q: Probability of survival to following year 1.00 0.75- 0.50 0.25 2 Clutch size (average number of eggs…

A: In a research study, variables refer to any place, process, thing, or individual on which the study…

Q: A normal cell has no growth factor bound to the growth factor receptor. What do you predict about…

A: The extracellular signal-regulated kinase (ERK) pathway is an important pathway that cells use to…

Q: e figure below shows an insect, pelican, and a magnolia tree. Please select at has the trait that is…

A: Cicadas show a extended life cycle with reproducing only once in their lifetime.Annual life cycle is…

Q: See image

A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: Can drugs interact with several neurotransmitters at once, and how would they do so?

A: When more than one drug alter each other's physiological effects, this is known as a drug…

Q: 2. One of the key pieces of information that Watson and Crick used in determining the secondary…

A: Deoxyribonucleic acid i.e DNA is the molecule that carries our genetic information to the next…

Q: Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance…

A: Cellular respiration involves the breakdown of glucose and the production of energy in the presence…

Q: DNA Replication and Protein Synthesis Review mmg Template strand SSB B- DNA polymerase Replication…

A: DNA replication is the cellular procedure for making an exact copy of its DNA. It's like making a…

Q: In squirrels, the gray allele (G) is dominant to the brown allele (g) at the coat color locus. A…

A: The principle is the genetic variation in a poulation will remain constant from one generation to…

Q: Match the items in the left column to the appropriate blanks in the sentences on the right. a higher…

A: The difference in equilibrium constants between fetal hemoglobin (HbF) and adult hemoglobin (HbA)…

Q: In ZZ-ZW sex determining systems which of the following is true? O Insects such as bees, wasps, and…

A: Sexually reproducing organisms show two types of sexual characteristics. They are responsible for…

Q: Below is a pedigree of a human blinding disease. Use this pedigree to answer the following…

A: Pedigree is a symbolic representation of inheritance pattern in a family. By the Pedigree chart we…

Q: two mutational events are sufficient to cause some forms of cancer, what distinguishes familial…

A: Generally, individuals inherit one mutation that can increase the chances of cancer. This mutation…

Q: what does the second number in the chromosomal location indicate like the number right before the…

A: It is the specific location of the gene which provides for information of the particular segment of…

Q: Classify each specific inhibitor or inhibitor characteristic according to one of two types of…

A: Enzymes are biocatalysts that are made up of amino acids that means they are proteinaceous in…

Q: 22 16 21 9 15

A: Species I - 2n =8 chromosomes (diploid)n is 4Species II - 2n = 14 chromosomes

Q: Draw fungal structural (spores) are mostly indicated with PINK stain (except in Image 5).

A: As per our company guidelines we are supposed to answer only first 3 parts. Kindly repost other…

Q: A woman and a man have a red-green colorblind daughter. What can you say about the genotypes of the…

A: Color blindness, particularly red-green color blindness, is a sex-linked recessive genetic trait.

Q: NT GENERATION te/ Gametophyte E IN ADULT ORGANISM R TISSUES PRESENT CELLS/IS WATER NEEDED? EX CELLS…

A: Bryophytes are lower plants that come after algae in the biological classification. Their body is…

Q: Briefly describe how thyroid hormones is made in the thyroid gland. What are the necessary…

A: The synthesis of thyroid hormones in the thyroid gland is a complex and highly regulated process…

Q: See image

A: AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: make a concept map out from the essay below. The epic story of a single sperm facing incredible…

A: Fertilization is a multi-step, complex process that takes 24 hours to complete. The beginning of…

Q: Drag the labels onto the diagram to identify the hormones of the endocrine system (2 of 2). ‒‒‒‒‒‒‒‒…

A: Endocrine gland is a gland which releases secretions into the blood to reach the specific target…

Q: fossil of what you think is the common ancestor of the new species of ape and all other gorillas.…

A: The whole branch of biology which deals with establishing the relationship between two species is…

Q: 15 These are the weakest bonds of all and are sensitive to pH as well as changes in temperature. a.…

A: There are different types of bonds or biological interactions found in living systems. These bonds…

Q: ✓ lipids fatty acid v cholesterol emulsifier sterols polyunsaturated fatty acid v bile saturated…

A: This worksheet is about fat related terms. Fat comprisers of oils,fatty acids, steroids, waxes,…

Q: genes, gene density, and number of exons. Prokaryote one gene every 2000 to 100000 bp mly large,…

A: Prokaryotes are the microorganisms which are usually unicellular and they are devoid of any membrane…

Q: An organism described as 2n=4 has the chromosomes below with genes indicated by letters and…

A: Mutation is the change in DNA sequence or the number of chromosomes in an organism. In some cases…

Q: What peptides are expected to be produced when an unknown hormone…

A: Large proteins can be broken down into smaller peptides by using different kinds of treatments like…

Q: Which of the following levels of organization is arranged in the correct sequence from most to least…

A: Ecosystem: An ecosystem is a broader concept that encompasses both living (biotic) and non-living…

Q: There are several main model systems through which the first set of major breakthroughs in the…

A: The initial advances in our comprehension of cell cycle regulation are the topic of the question.…

Q: Evolution results from A. mutations. B. natural selection. C. genetic drift. D. gene flow. E.…

A: It is the change in the characteristics of species over generations. It relies on the process of…

Q: Which statement best describes how molecular complementarity enables specificity during a signaling…

A: Cell signalling, also known as cell communication, is a cell's ability to receive, analyse, and…

Q: 100 implants 4,500 hrs of testing the implants 4 implants failed halfway through failure rate is…

A: The method of testing implants could be a critical viewpoint in ensuring their reliability and…

Q: Viruses without borders" is what it means? What's the reason that viral infections are going up as…

A: Viruses without borders" means that viral infections don't respect geographical boundaries. They can…

Q: What is the purpose of the fruit we (and other animals) eat, from the plant's perspective? Group…

A: A fruit is the mature ovary of a flowering plant, typically containing seeds. It develops from the…

Concept explainers

Microbes

Microbes are microscopic living organisms that can only be detected with the help of specialized laboratory equipment called a microscope. These living organisms are so small that they are not visible to the naked eye.

Question

100%

Chemolithrophs near hydrothermal vents support a variety of other life forms there. Explain now their role is analogous to that of photosynthetic organisms in the terrestrial environment.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduce chemolithrophs

VIEW

Step 2: Explanation of analogs

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Although chemoautotrophs serve as the primary producers near hydrothermal vents, animals there still ultimately depend on the photosynthetic activities of plants and cyanobacteria. Why?
Compare photolithoautotrophy with chemolithoautotrophy. Do you think it is possible for an ecosystem to exist solely on the organic carbon generated by chemolithotrophy (i.e., without any contribution by photosynthetic organisms)? Explain your reasoning.
Why might chemosynthetic communities exist only in places like the deep-ocean floor rather than across a wide range of land and sea habitats, the way photosynthesis-based communities are?
Compare photo litho autotrophy with chemo-organo heterotrophy. Sun light is the ultimate source of energy and all living organisms obtain their energy directly or indirectly from the sun. However in deep-sea vents (where there is no sun light) life has originated and the many groups of microorganisms are flourishing in such environment. How? Explain your reasoning
The common name for species like Anabena is blue-green algae. This group of bacteria are capable of photosynthesizing. Do they contain chloroplasts? Explain.
Many pelagic Bacteria can use light energy but arenot considered “phototrophs” in the same sense ascyanobacteria or purple bacteria. Explain.
Explain why C4 photosynthesis is advantageous in hot, dryconditions
Reverse electron transport makes unique ecological niches available to micro-organisms.Briefely explain this.
Discuss the possibility of life on Mars. In reference to extremophiles. Defend or refute this statement: The upper-temperature limit to life is unrelated to the stability of proteins or nucleic acids. How influential is microbial activity on the geological processes of mineral formation and deposition compared to biological processes? (argue both sides of this one). What challenges and advantages do you see with the use of extremeophiles in industrial or bioremediation applications?
Blue-green algae (cyanobacteria) form heterocysts when deprived of ammonia and nitrate. In this form, the cyanobacteria lack nuclei and are attached to adjacent vegetative cells. Heterocysts have photosystem I activity but are entirely devoid of photosystem II activity. What is their role?
Reverse electron transport makes unique ecological niches available to microorganisms. Explain this statement
Based on our current knowledge of biology on Earth, above what temperature (in °C) would biological activity become impossible, and why? Based on our current knowledge of extremophiles, below what temperature (in °C) would the last surviving organisms cease their activity?