Q: ◄× x A B C D Biomolecules are essential to all living things. Which biomolecule is "D" from the…
A: Biomolecules are complex molecules which are made up of various monomers linking together with each…
Q: How do the processes of capacitation and acrosome reaction affect the fertilization process?
A: Fertilization is a multi-step process in which sexual reproduction starts with the combination of a…
Q: List and describe the 3 types of blood cells that make up your blood.
A: 1.RED BLOOD CELL 2. WHITE BLOOD CELL 3. PLATELET
Q: II. Identify the numbered parts of a typical plant cell. 1. 2. 3. 4. 11. 10. 5. 9. 8. 6. 7.
A: The plant cells are eukaryotic cells that contain membrane bound cell organelles. The presence of…
Q: A. Compute for the total magnification of an image under the LPO for both microscopes. B. Calculate…
A: Microscopes are one of the most valuable and essential pieces of equipment in a laboratory. they are…
Q: L Name the structure with the blue line across it. nd Osteon ETTE A
A: Introduction Bone is a solid bodily tissue made up of cells encased in a lot of dense intercellular…
Q: Explain each of these properties of water, and describe how each is conferred by the dipolar nature…
A: Water is the primary component of the Earth's hydrosphere and the fluids of all known living things.…
Q: . Why is it helpful that the transmission compound light microscopes we studied in the lab are both…
A: A microscope is a scientific tool used to examine objects that are too small to be seen with the…
Q: A student comes across these numbers for the F1 progeny when they crossed a white, spotted fish and…
A: Introduction : The dominant allele is the one that manifests its influence on the phenotype of an…
Q: What might be the professional drawbacks of depending on a single theory of aging?
A: Like every theory of science theory of aging also has certain drawbacks which can have a great…
Q: The kidney is a target of several complicated pathways, but the effects can be summarized as the…
A: Introduction: Humans have two kidneys, which are two reddish bean-shaped organs that are situated…
Q: How do the pathologic changes and clinical manifestations of syphilis differ during the incubation,…
A: The spirochete Treponema pallidum causes syphilis, an infectious venereal disease. The transmission…
Q: answer 6, 7, 17 that would fit to the puzzle
A: Cell biology is an area of biology that focuses on understanding the composition, division,…
Q: The bacterium Dontuplodemeus tocheggus has a generation time of 20 minutes. Starting with one cell…
A: Bacteria are a family of rod-shaped bacteria that are often found in soil or water. They are known…
Q: #7
A: We know that Viruses are ultramicroscopic, noncellular infectious nucleo-proteins. Viruses inside a…
Q: Nervous tissue makes up the __________ ___________ and serves what 2 functions
A: Nervous tissue make up neuron and glial cell.Most of Neuron have three most important part 1.…
Q: Explain the three ways in which the energy is regulated in cells.
A: The size of enzymes ranges from small, simple molecules to extremely complicated compounds. The…
Q: Virtual Experiments Procedure A. lodine Test for the Presence of Starch 1. Gather the following food…
A: Iodine is used as an indicator in the starch hydrolysis test. It is frequently used in industry to…
Q: What is the importance of normalization of data in fluorescence spectroscopy
A: Introduction :- An electromagnetic spectroscopy technique called fluorescence spectroscopy examines…
Q: Note : — don't copy in google or bartleby. Plagarize checker will be used. QUESTION : How does…
A: Introduction :- In order to enable mobility, certain plant and animal sperm cells as well as a…
Q: What are the predisposing factors and characteristics common to inflammatory disorders of the…
A: Inflammation of the gut or digestive tract that persists for a long time is known as inflammatory…
Q: Which of the following is not a contributor to genetic variation? (a) replication of sister…
A: Genetic variation means the diversification of the sequences present in the genome of an organism.…
Q: What should be the frequency of the AA, Aa, and aa genotype if the population is in Hardy- Weinberg…
A: If the allele and genotype frequencies remain same generation after generation then we can say that…
Q: Which of the following is true about the organism which grew at both 37°C and 4°C in the figure…
A: The growth of the organism is very much confluent in 4oC and 37oC respectively.
Q: Place the following events of sexual reproduction in the correct order by numbering them from 1 to…
A: The process of reproduction requires gamete synthesis through the process of meiosis. Meiosis…
Q: Connective Tissue Types ▪ Bone (osseous tissue) ▪ Bone cell name? ▪ Bone functions? -Bone cells in…
A: There are 3 special kinds of cells that are found solely within the bone.These cell names all begin…
Q: If a membrane had 1 billion molecules, how many phospholipid molecules, cholesterol molecules, and…
A: The thin, living, elastic, semipermeable lippopotamus membrane that is present around the cell is…
Q: What major obstacle confronted Darwin’s theory of natural selection when it was first proposed? How…
A: Evolutionary biology owes much to Charles Darwin, whose discussions of common descent and natural…
Q: How does population density affect the physiology and behavior of organisms?
A: In nature, there are various constraints on population number and expansion. Some are depending on…
Q: In a Microscope : When you move the slide to the right using the mechanical stage lever while…
A: Compound microscopes are optical instruments that have two lenses: a primary lens creates a real…
Q: Which characteristic is a disadvantage of hydroelectric plants? O Low net energy O Large land…
A: Introduction Conservation biology is that the study of the conservation of nature and of Earth's…
Q: What are the advantages and disadvantages of using benzodiazepine hypnotics versus non -…
A: Introduction Benzodiazepines are a class of drugs that can treat a range of conditions. Familiar…
Q: The sequence of the amino acid residues? Accession number at GenBank ? Determine the mRNA sequence…
A: There are a few important points that should be kept in mind : Amino acids are compounds containing…
Q: You transform tetracycline sensitive competent cells with a plasmid solution (the plasmid encodes…
A: Tetracyclines were discovered in the 1940s and exhibited activity against a wide range of…
Q: What are the risk factors and clinical manifestations for bladder cancer?
A: Bladder cancer is a type of cancer in which cells of the bladder called urothelial cells divides…
Q: List five proteins of the myofilaments
A: We know that Muscles are the soft tissue found in our body. Muscles work to create strength and…
Q: Define the various forms of rRNA found in bacteria ?
A: Bacteria is a prokaryotic organism. It is microscopic in nature and hence can be visualized only…
Q: Which plasma membrane component can be either found on its surface or embedded in the membrane…
A: The top layer of animal cells is called the plasma membrane. Singer & Nicholson described the…
Q: Describe the respective contributions of the genetic approach and cell biology to formulating the…
A: The study of cell structure and function is known as cell biology, and it is based on the idea that…
Q: Listen III Name this tissue. Be specific the lines (or bands) the blue arrows are pointing to. A/ A/…
A: Introduction :- In biology, a tissue is described as a collection of cells that have a same…
Q: Define the terms oviparous, ovoviviparous, viviparous and distinguish among them.
A: The biological process of reproduction is how a new, unique organism is created from its parents. It…
Q: Match the scientist and their discovery of the causative agents of the disease Options: Spanish…
A: Spanish flu It refers to the 1918 influenza pandemic. It was a deadly global influenza pandemic…
Q: 1. To produce a specialized-transducing mycobacteriophage construct, a cosmid bearing the allelic…
A: Cosmids :- These are the vectors, which are constructed by using hybrids of lambda…
Q: 44. In humans, the plasma comprises what percentage of the blood? a. 45 percent b. 55 percent…
A: We know that Blood is a fluid connective tissue composed of cellular parts like red blood cells…
Q: Describe how paedomorphosis as a mechanism could explain the evolution of the chordate body plan…
A: Explanation: Paedomorphosis is a mechanism that can explain the evolution of the chordate body plan.…
Q: Describe the mechanism through which the substance moves across the cell membrane and comment on the…
A: The physical components of the body, known as organs, have specialised purposes. They are made up of…
Q: How can the recovery of Retinal blindness be made?
A: The human eye is a very important organ of the human body as it helps in visualizing things or…
Q: In the overall process of photosynthesis, oxygen atoms are ________ and carbon atoms are _________…
A: Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create…
Q: what are the ways on how protozoans eat?
A: Protozoans are eukaryotes with a single cell lacking cell walls. They consume both organic materials…
Q: Drag each characteristic to the correct category. Viruses do not possess all the characteristics of…
A: Introduction : A virus is composed of a core of genetic material, either DNA or RNA, that is…
Step by step
Solved in 2 steps
- You seed another culture of different end cell line, Walker12 cells, at 8 am on Friday with 10^4 cells. By Thursday at noon (12:00 pm) they reach confluence. Assume the sae confluency as stated above for a T150 flask (culture area of 150cm^2 adn when confluent contains 2 x 10^7 cells). What is the generatoin time (doubling time)? A. 120 hours B. 80 hours C. 38 hours D. 8 hours E. 11.4 hours F. other ________A small fraction—2 to 3%—of all cancers, acrossmany subtypes, displays a quite remarkable phenome-non: tens to hundreds of rearrangements that primarilyinvolve a single chromosome, or chromosomal region.The breakpoints can be tightly clustered, with several in afew kilobases; the junctions of the rearrangements ofteninvolve segments of DNA that were not originally closetogether on the chromosome. The copy number of varioussegments within the rearranged chromosome was foundto be either zero, indicating deletion, or one, indicatingretention.You can imagine two ways in which such multi-ple, localized rearrangements might happen: a progressiverearrangements model with ongoing inversions, deletions,and duplications involving a localized area, or a cata-strophic model in which the chromosome is shattered intofragments that are stitched back together in random orderby nonhomologous end joining (Figure Q20–2).A. Which of the two models in Figure Q20–2 accountsmore readily for the features of…Please asap. thankyou. The following diagram represents the results of hemoglobin samples of 5 patients (1-5) that were run on an electrophoresis gel at pH 9.2. The first 3 lanes show the control samples, for comparison. Using only the letters "AA" "AS" and "SS", fill in the blanks below indicating the most likely genotype of each patient, based on these protein electrophoresis results. The following diagram represents the results of hemoglobin samples of 5 patients (1-5) that were run on an electrophoresis gel at pH 9.2. The first 3 lanes show the control samples, for comparison. Using only the letters "AA" "AS" and "SS", fill in the blanks below indicating the most likely genotype of each patient, based on these protein electrophoresis results. Patient 1 Patient 2 Patient 3 Patient 4 Patient 5
- Hi! Can you give an explanation for each sample identity in paragraph form (for the rationale)? Thank you.What would you use the following programs for: Blastn Blastp Tblastn Global alignment CD-search Pfam Megablast PSI-blastPlease ASAP. Thank you. Bodi had his DNA tested using some of the CODIS primers. His results have been analyzed and are listed below, with the calculated frequencies of having each genotype separately. Locus name Bodi's genotype Frequency of that genotype TPOX 8,8 0.0352 D5S818 11,13 0.13 D3S1358 15, 18 0.082 D16S539 11,11 0.095 What is the probability that any human on Earth would have this exact combination of genotypes? Show your work and give your answer in scientific notation.
- In histopathology, why do different stains have different affinities for different organisms or different parts of organisms? Explain and include the Hematoxylin and Eosin staining as an example to further understand. Please answer the question concisely and don't just simply give the meaning of Hematoxylin and Eosin staining.Please answer fast One hundred and forty seven plaques were counted from a 10-7dilution plate when 0.1 ml of bacteriophage-infected bacteria was plated. What was the original bacteriophage density?Why is this technique used?
- #3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:An ade+ arg+ cys+ his+ leu+ pro+ bacterial strain is knownto be lysogenic for a newly discovered phage, but the siteof the prophage is not known. The bacterial map isleucysarghisadeproThe lysogenic strain is used as a source of the phage, andthe phages are added to a bacterial strain of genotypeade- arg- cys- his- leu- pro-. After a short incubation,samples of these bacteria are plated on six differentmedia, with the supplementations indicated in thefollowing table. The table also shows whether colonieswere observed on the various media.PresenceMedium Ade Arg Cys His Leu Pro of colonies1 - + + + + + N2 + - + + + + N3 + + - + + + C4 + + + - + + N5 + + + + - + C6 + + + + + - NNutrient supplementation in medium(In this table, a plus sign indicates the presence of anutrient supplement, a minus sign indicates that asupplement is not present, N indicates no colonies, and Cindicates colonies present.)a. What genetic process is at work here?b. What is the approximate locus of the prophage?True ans false 1. MERS can spread by faecal-oral route and/or aerosol droplet transmission 2. Parvoviruses has very small linear dsDNA at 5000 kb and can only replicate when the cell is co-infected with an adenovirus 3. The Ki-67 protein is a cellular marker for proliferation, and during interphase, it can be exclusively detected by immunohistochemistry within the cytoplasm, but it is absent in quiescent cells (G0)