Gene B Gene A 4 Numbers Indicate reglons that are subcloned. Gene B Starting clone Cosmid vector Subclone. Screen a library. Second clone Subclone. Screen a library. -Third clone Repeat subcloning and screening until gene A Is reached. Gene A FIGURE 23.11 The technique of chromosoome walking.

Gene B Gene A 4 Numbers Indicate reglons that are subcloned. Gene B Starting clone Cosmid vector Subclone. Screen a library. Second clone Subclone. Screen a library. -Third clone Repeat subcloning and screening until gene A Is reached. Gene A FIGURE 23.11 The technique of chromosoome walking.

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 5SQ: A set of cells that host various DNA fragments collectively representing an organisms entire set of...

See similar textbooks

Related questions

Q: • a DNA ladder with markers every 200 bp (DNA Ladder) • the resulting restriction fragments of the…

A: Restrictions endonuclease Restriction endonuclease are the enzymes which cleaves the DNA at the…

Q: How can DNA microarrays be used to determine which genes of a bacterial pathogen are expressed both…

A: DNA microarray or biochip is a technique wherein different DNA molecules are first attached to a…

Q: Why must the gene be inserted into a vector for it to be cloned?

A: Vectors are carriers of target DNA which are readily used in recombinant DNA technology. The most…

Q: hich repair mechanisms is most require to fix thymine dimers? BER NER mismatch repair…

A: When many proteins and RNAs are damaged, they will be degraded and sugars, are metabolized in order…

Q: Which of the following polymerase Il play a key role in? Please make sure to select ALL correct…

A: RNA polymerase II is an enzyme found in eukaryotic cells . Precursors of mRNA are formed by…

Q: The drawing below depicts a restriction map of a segment of a human chromosome. The cut sites shown…

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. If you need help with other sub…

Q: During conjugation,. HFR; F+ function as DNA donors and, function as DNA recipients. F+; F- F-; F+…

A: Conjugation is a type of horizontal gene transfer seen in prokaryotes.

Q: During the ________ phase, the cell accumulates building blocks and energy resources to copy its…

A: INTRODUCTION S phase This is the phase in which DNA is replicated, occurring between G1 and G2.

Q: estion 15 Genomic annotation O requires STSS O identifies the location and function of genes both a…

A: Gene annotation is necessary because the sequencing of DNA produces sequences of unknown function.

Q: In Figure 5-12,a. Which Hfr gene enters the recipient last? (Whichdiagram shows it actually…

A: Some bacteria will have F-plasmid integrated with the chromosomal DNA, they are known as…

Q: Page 6 of 6 Describe the cloning vectors that would be used to clone each of the following DNA…

A: A cloning vector is a short fragment of DNA that allows the incorporation of foreign DNA for…

Q: What color colonies will cells that contain a recombinant plasmid form?

A: Recombinant plasmids are the vectors that carry target DNA or gene sequence to the host by the help…

Q: ite a note on the cloning vector.

A: Cloning is a process that allows scientists to create perfect genetic duplicates of living…

Q: magine you are working in a lab that is developing a novelty rose that smells like a stinkhorn…

A: Introduction Recombinant DNA technology is advanced technology to produce hybrids plants and animals…

Q: Based on this AGE profile, which of the following statements is NOT TRUE? M Uncut Ndel Ndel (Pure)…

A: Electrophoresis is a method that uses an electric field to separate macromolecules in a fluid or gel…

Q: The presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome…

A: Bacteria are a prokaryotic microbe which have undefined nucleus and nuclear membrane. Bacterial…

Q: DNA saquance of interest DNA of interest Open vector Vector containing DNA of interest -Vector DNA…

A: When a genetically changed vector is injected and integrated into the genome of an organism (host),…

Q: R. Alu 100 100 300 F ----- 100 100 Where would you expect to see a band or bands if you used PCR to…

A: 500 bp template was prepared by using amplified PCR with forward and reverse primers of 100 bp each…

Q: Female with pentsuria. Makes no detectable "X" protein. X Is the reductase. Parents are third…

A: There are few important point to know about Pentsuria. It is an inborn error carbohydrate…

Q: Why are the first 20 bases typically ignored from a Sanger sequencing ab1 file? O The data quality…

A: The most commonly used tool for detecting SNVs is Sanger sequencing, it involves DNA polymerase…

Q: Match the definition on the left with the term on the right Tightly hypercolled DNA that is not in…

A: The DNA is the genetic material in human that is present within the nucleus of a cell. This DNA…

Q: 汽 (0 hope this picture, https://www.phys.kSu.edu/gene/photos/sd.html. 2 will help you imagine the…

A: Isolation is a microbiological technique in which individual bacterial colonies are separated from a…

Q: nucleotide is in the left column, and second codon nucleotide is on top. The m allele sequences are…

A: Sense strand of the coding strand is the segment of DNA that carries the code that can be…

Q: WHOLE CHROMOSOME ARE NOT ANALYZED IN DNA FINGERPRINTING METHOD.

A: Deoxy ribonucleic acid or DNA fingerprinting is a way to identify a certain individual rather than…

Q: Which of the following contain only the sequences required for transposition and the genes for…

A: Transposons are the DNA sequence which can change their position within the genome. It may be simple…

Q: What the most likely cause of mutation CCC to CCG? Select an answer and submit. For keyboard…

A: Mutation as the process to change or cause a permanent change in the DNA of an organism. This can be…

Q: Are you a hidden heterozygote? A PCR analysis (part2) Agarose gel electrophoresis and interpretation…

A: Agarose gel concentration More the concentration of the agarose gel more smaller will be its pores.…

Q: What is a contig?

A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…

Q: In Figure 5-18c, why is the crossover shown occurring inthe orange segments of DNA?

A: Crossing over is a process in which DNA or genes are exchanged between two homologous chromosomes…

Q: CRISPR-Cas9 technology can edit the DNA in random regions True False

A: CRISPR Cas9 technology can edit DNA in precise specific locations and not rand DNA regions. CRISPR…

Q: Part 2: Answer the questions below to indicate how the recombinant DHFR fusion protein wilI be…

A: coli RNA polymerase, directs the expression of the dhfr gene cloned into the plasmid.

Q: #2 under Process: DNA is copied from the 3' prime to the '5 prime end. True False

A: DNA replication is the semiconservative process of formation of the daughter DNA strand from the…

Q: Im having trouble answering this question. What type of cells can be altered by GETs like CRISPR…

A: The gene therapy or gene editing is an asset for humans, as many of the gene-related disorders can…

Q: Fig. 1 shows a simple illustration how recombinant DNA are made. DNA sequence of interest DNA of…

A: The picture describes the process of making recombinant DNA. A recombinant DNA is a DNA molecule…

Q: The presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome…

A: Bacteria are a prokaryotic microbe which have undefined nucleus and nuclear membrane. Bacterial…

Q: Non-conventional genetic engineering transformation method for transfer of wheat lysine genes in to…

A: Introduction :- Genetic engineering is the process of modification of an organism's phenotype by…

Q: Jsing the picture below determine the type of mutation that has occurred. Mutated Chromosome

A: Any abrupt alteration in the nucleotide sequence of genes is defined as a mutation. It can also be…

Q: The sequences of the recombination sites recognized by site-specific recombinases area) Partially…

A: Recombination is a process by which pieces of deoxyribonucleic acid (DNA) are broken and recombined…

Q: Create a 75-nitrogenous base long DNA and replicate it completely. Make sure initiation, elongation…

A: Replication of DNA : DNA replication is the process where a new strand exactly similar to the…

Q: What types of genes may make up the mobile gene pool?

Q: gun sequencing ncing every gene is mapped then

A: Shotgun sequencing is a method used for DNA sequencing. It is carried out by breaking the DNA…

Q: A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the…

A: PCR is polymerase chain reaction that amplifies given DNA molecule into many copies of specific DNA…

Q: a.) wanting to clone gene Z into pVector, the gene is amplified by PCR and restriction sites are…

A: Plasmid vectors provide a simple way of cloning small DNA fragments in bacterial and simple…

Q: What is chromosome walking?a) Hybridization techniqueb) Sequencing techniquec) Genetic markerd)…

A: Chromosome walking is a cloning technique that uses a genetic marker to probe a genomic library.…

Q: Why do some cells grow on the control plate in the absence of a mutagen?

A: The DNA is made of nucleotides joined together by a phosphodiester bond. The nucleotide sequence of…

Q: Directions: Below is a more in-depth look at a replication bubble. All of the parts are still the…

A: Please find the answer in step2:

Q: Whole chromosome are not analyzed in DNA fingerprinting method. Explain.

A: Introduction: DNA is a genetic materiel of living organism except in some viruses. DNA…

Q: Which type of DNA cleavage is done in the Maxam Gilbert method?a) Edgeb) Interstitialc)…

A: Deoxyribonucleic acid (DNA) sequencing is the process of determining the nucleic acid sequence based…

Question

Why is this technique used?

Gene B
Gene A
4
Numbers Indicate
reglons that are
subcloned.
Gene B
Starting
clone
Cosmid
vector
Subclone.
Screen a library.
Second clone
Subclone.
Screen a library.
-Third clone
Repeat subcloning and
screening until gene A
Is reached.
Gene A
FIGURE 23.11 The technique of chromosoome walking.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Genes of same species, similarly related to each other area) Orthologb) Syntenyc) Paralogd) Microarray
SCRAMBLED WORDS: 1. Arrange the scrambled words to form a term related to genetics. 2. After you have formed the words, describe or define the new terms. ennamoidc plluitem leeasll peissaist helatl llaese dooceacminm
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
explain the statement Duplications Provide Extra Gene CopiesThat Can Acquire New Functions
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
27) SDS-PAGE 28) Reading DNA, RNA and protein sequences 29) Cloning vectors
1 Restriction enzymes cut DNA molecules atspecific locations to produce restriction fragments witheither blunt or _______ ends
A small fraction—2 to 3%—of all cancers, acrossmany subtypes, displays a quite remarkable phenome-non: tens to hundreds of rearrangements that primarilyinvolve a single chromosome, or chromosomal region.The breakpoints can be tightly clustered, with several in afew kilobases; the junctions of the rearrangements ofteninvolve segments of DNA that were not originally closetogether on the chromosome. The copy number of varioussegments within the rearranged chromosome was foundto be either zero, indicating deletion, or one, indicatingretention.You can imagine two ways in which such multi-ple, localized rearrangements might happen: a progressiverearrangements model with ongoing inversions, deletions,and duplications involving a localized area, or a cata-strophic model in which the chromosome is shattered intofragments that are stitched back together in random orderby nonhomologous end joining (Figure Q20–2).A. Which of the two models in Figure Q20–2 accountsmore readily for the features of…
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
The main aim of human genome project isa) To identify and sequence of all the genes present in the human bodyb) To introduce new genes to human beingsc) To remove disease causing genes from humansc) To improve techniques of finger printing
Sequencing of genomic DNA is included ina) Phenotypic functionb) Cellular functionc) Molecular functiond) Structural genomics