✓ Choose... James Watson and Francis Crick Pulsed Field Gel Electrophoresis (PFGE) ddNTP Frederick Sanger Consanguineous mating Marfan's syndrome Yeast Artificial Chromosomes (YACs) P1 Derived Artificial Chromosomes (PACS) Transposable elements Paternal inheritance Choose... 4
Q: QUESTION 22 Which compartments are topologically equivalent with the nucleus? OA. ER and…
A: Introduction : Cell organelles are specialised subunits that carry out particular activities and…
Q: The frequency of the defective allele of a gene for an autosomal dominant disorder is 1/5. In a…
A: Introduction Autosomal refers to the 22 pairs of chromosomes in humans that are not involved in…
Q: Compare and contrast the Oogenesis and structure of the ovaries of: Rat (Vertebrates) Starfish…
A: Oogenesis is the process of forming female gametes or eggs. It is the process by which a diploid…
Q: 17. Human plasma-derived products characteristics. The application of human plasma-derived products…
A: Plasma is the liquid component of blood that makes up about 55% of the total volume of blood in the…
Q: Please answer fast Imagine that you have a water sample containing two different species of…
A: Microbial isolation techniques can be used to grow pure cultures of microorganisms, which can then…
Q: What are 3 ways disinfectants work to destroy bacteria?
A: Introduction: Disinfection is the process of eliminating or reducing the number of microorganisms,…
Q: June Johnson is a 55-year-old female who was admitted to the hospital during two hours of crushing…
A: Afterload is the resistance that the heart must overcome in order to eject blood during systole (the…
Q: Why does intake of dietary fiber associated with decrease risk to athersclerosis
A: The term Atherscelroisis is used to refer to a condition in which there is an increased buildup of…
Q: The nuclear pore complex allows for: (select all that apply) passive diffusion of mRNA import of…
A: The nuclear pore complex (NPC) is a large protein complex that spans the nuclear envelope, the…
Q: QUESTION 28 Which of the following describes how a protein is inserted into the ER membrane? OA. It…
A: Introduction: Endoplasmic reticulum is present in all eukaryotic cells. Its membrane normally makes…
Q: there can only be one answer
A: A genus is a taxonomic rank used in biological classification that groups together one or more…
Q: F 400 800 pCi (μmol mol ¹) 1200 A. The function of phosphoglycerate kinase was studied in response…
A: Photosynthesis is essential for controlling the Earth's carbon cycle. Plants and algae take CO2 from…
Q: According to this slide, which question below identifies more the picture a. Uncontrolled high…
A: Over time, the constant strain on the blood vessels from high blood pressure can cause damage to the…
Q: Your friend wants to develop a new method to map the transcription start and end sites of a target…
A: Transcription is the process by which genetic information in DNA is used to synthesize RNA…
Q: what does ATP stand for and I don't understand the words circled in the image I provided
A: Introduction Cellular respiration is the process by which cells break down molecules such as…
Q: Molecule X MMP-2 cleavable sequence Molecule Y
A: The imaging agent in the figure consists of two molecules - molecule X (donor) and molecule Y…
Q: You are a mad scientist tasked with the evil job of designing a novel species. This species will be…
A: As a scientist the job is to make a species which will be very vulnerable for ecosystem. So, we have…
Q: Write a sentence or two defining the essential function or structure where ppropriate of the…
A: The cell contains various cellular organelles like nucleus, mitochondria, chloroplast (in plants),…
Q: What are the basic and unique healthcare needs of the elderly population.
A: Introduction: Health maintenance and enhancement through medical, surgical, and preventive…
Q: This UCP1 protein allows the protons (H+) of the mitochondrial intermembrane space to enter the…
A: UCP1 is a unique protein that plays a critical role in thermogenesis and energy balance, and it may…
Q: In chickens, comb appearance is controlled be a specific gene that can occur in dominant form (R),…
A: Introduction: Gregor Mendel, a monk who experimented with pea plants in the middle of the 19th…
Q: How does palladium work in a reaction?
A: Palladium is a platinum group element that is rare and silvery-white in colour. It is well-known for…
Q: Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in…
A: The amino acid sequence is the translated sequence of DNA sequence. During translation process, DNA…
Q: Explain the interconnectedness of sexual orientation, gender identity, and gender expression IN…
A: Sexual orientation refers to a person's enduring pattern of romantic, emotional, and/or sexual…
Q: 11. The following is a list of abiotic factors that would have a micro-effect on a tidal pool (rocky…
A: Answer :Water chemistry ( pH ,pollution etc) Reason: Abiotic factors are ecological elements that…
Q: state three ways main in which the body uses food ?
A: Food that we eat is ultimately broken down into simpler substances by the help of various enzymes in…
Q: Give the different types of reflexes and explanation . Tabulate your answer.
A: Introduction Reflexes are involuntary, automatic responses of the nervous system to a particular…
Q: Give 3 factors affecting the distribution of sunlight
A: Sunlight is the electromagnetic radiation emitted by the Sun, particularly in the visible and…
Q: Transport Across the Cell Membrane Worksheet 1. For each of the following examples, state whether…
A: Tonicity in chemical biology is a measurement of the efficient osmotic pressure gradient, or the…
Q: 1. What is the state of DNA at the end of meiosis I? What about at the end of meiosis II? 2. Why are…
A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby…
Q: The initiative-versus-guilt stage of psychosocial development is characterized by a child feeling a…
A: The initiative-versus-guilt stage of psychosocial development, according to Erik Erikson's theory,…
Q: Which of the following statements concerning drug delivery system is INCORRECT?* A.Drugs with good…
A: Introduction The term "drug" can refer to any substance that alters the functioning of the body…
Q: Which environment is most conducive to a child developing a rich vocabulary quickly? formal…
A: As parents, caregivers, and educators, we all want children to develop strong language skills,…
Q: 1. On paper, write out the first 30 bases in the middle of the page in order. You want ensure you…
A: Introduction : DNA stands for deoxyribonucleic acid. It carries genetic information from one…
Q: Why Eukaryotes is better than prokaryotes?
A: Introduction : Prokaryotes are most primitive and simple organisms. They lack double membrane-bound…
Q: Show a diagram on how carbohydrates, proteins, and fats breakdown in the body for energy
A: Metabolism is essential for life as it provides the energy required for various cellular functions,…
Q: James Lind conducted a research study in which he divided 12 sailors into six pairs and gave a…
A: Experimental study consists of an independent variable, dependent variable and control variable.…
Q: ven the following scanning electron image, what general type of cell are we looking and why? 1.0 um…
A: The proteins that are studied are chosen on the basis of the fact that they remain conserved in all…
Q: Describe the sharks' skin coloration, scales, skeleton, appendages, body form, and position of its…
A: Introduction :- Sharks are a diverse group of fish that have been around for over 400 million years,…
Q: In populations where it is common for first cousins to marry, some autosomal recessive disorders…
A: Introduction : According to the Hardy-Weinberg principle, the frequency of the allele in a…
Q: Place the following events in the proper order to describe the production of a second messenger from…
A: G protein coupled receptors (GPCRs) are a large family of cell surface receptors that play a variety…
Q: Topic: My 600 life Ib life In a paragraph write your thoughts on their stories. What nutrition…
A: Introduction Nutrition refers to the study of how food and nutrients impact human health and…
Q: Hello, correction, instead of E-excuse, it should be E-Example, can you revise the answer please…
A: Endocrine glands are specialised ductless glands which secrete chemical messengers called hormones.…
Q: Some drugs require rectal administration because * they can undergo first-pass metabolism. O small…
A: Introduction :- Drugs are chemical substances that alter the normal function of the body when they…
Q: Lymph drainage is important for what functions? (Check all that apply.) Check All That Apply…
A: Introduction :- Lymphatic drainage, also known as lymphatic circulation, is the process by which the…
Q: 3. We made 450 mL of 2.5% Luria Broth (LB) for our bacterial cultures. a) What is the final…
A: Every biological cell requires some kind of energy (nutrients) for its growth and development. For…
Q: Why would you look for ARGs in a farming context And why specifically in the waste manure produced…
A: In the context of microbiology and genetics, ARG stands for antibiotic resistance gene. These are…
Q: Please help with my homework assignment Need to discuss Adderall and any and all relevant nervous…
A: Adderall is a medication primarily used to treat attention deficit hyperactivity disorder (ADHD) and…
Q: primary and metastatic uveal Mel202 and OMM1.3 cells.
A: NOTE- AS PER OUR BARTLEBY GUIDELINES , IF MULTIPLE QUESTIONS ARE GIVEN WE HAVE TO SOLVE ONLY FIRST…
Q: When your white blood cells encounter pathogens, they use harsh chemical reactions to destroy…
A: Vitamin C is also known as Ascorbic acid ( a water soluble vitamin), which plays vital role in…
Step by step
Solved in 3 steps
- During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicaseMutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’ Amino acid sequence of peptide: Type of mutation:Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’ Complementary DNA sequence: mRNA sequence transcribed from template: Amino acid sequence of peptide: Type of mutation:
- why is recombinant DNA is possible becuase we know dna molecules from all organisms share the same chemical structure and differ only in the nucleotide seqeunce within the identical structureMutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’ Complementary DNA sequence: mRNA sequence transcribed from template:An alien organism was investigated. When DNA replicationwas studied, a unique feature was apparent: NoOkazaki fragments were observed. Create a model of DNAthat is consistent with this observation.
- Chromosomal ____________include those that removeor add base pairs (deletions and duplications), and thosethat relocate DNA regions (inversions and translocations).DNA Replication Terms _____DNA polymerase III _____Primase _____Helicase _____Lagging Strand _____Leading Strand _____RNA Primer _____Single Strand Binding Protein _____5’ _____3’ _____DNA Ligase _____ Topoisomerase _____Template Strand _____Coding StrandThe enzyme responsible for separating double-stranded DNA intosingle-stranded DNA isa. DNA helicase.b. DNA primase.c. DNA polymerase.d. DNA ligase.
- DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OHMultiple origins of replication on the DNA molecule of eukaryotic cells serve to Question 41 options: remove any errors in replication that may have occurred create multiple copies of the DNA molecule at the same time shorten the duration of time necessary for DNA replication reduce the number of "replication bubbles" that occur in the DNA double helix during replication assure the correct orientation of the two strands in the newly growing double helixSelect the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made