b. Given the following scanning electron image, what general type of cell are we lookingat and why?HIGH1.0 umc. As a researcher, you were able to sequence a circular piece of DNA from the organismbelow:caceM4020533008363CODDEGOEDHow would you go about determining if the organism is a prokaryote or eukaryote? Plantae1. Molecular and microscopy analyses have provided evidence for relationships among 75lineages of eukaryotes and their distinctness from prokaryotes.Green AlgaeRed AlgaeAlveolatesStramenopilesChlorophytesTrebouxiophytesFloridiophytesBangiophytesCyanidiophytesGlaucophytesApicomplexaColpodellaDinoflagellatesUlvophytesPrasinophytesMesostigmaOxyhrrisPerkinsusCiliatesColponemaEllobiopsidsDiatoms.RaphidiophytesEustigmatophytesChromalveolatesChrysophytesPhaeophytesBolidophytesBlastocystisActinophryidsLabyrinthulidsThraustrochytridsStreptophytesLand plantsCharophytesOomycetesOpalinidsBicosoecidsHaptophytesHIGHCryptomonadsDiscicristatesHeteroloboseaKinetoplastidsDiplonemidsEuglenidsCore jakobidsTrimastixOxymonadsTrichomonadsLoboseaArchamoebaeHypermastigotesCarpediemonasRetortamonadsDiplomonadsMalawimonadsCercomonadsEuglyphidsPhaeodareaHeteromitidsDictyostelidsMyxogastridsProtostelidsPhytomyxidsHaplosporidiaThaumatomonadsChlorarachniophytesForaminiferaPolycystinesAcanthariaAscomycetesBasidiomycetesZygomycetesMicrosporidiaChytridsNucleariidsAnimalsChoanoflagellatesAmoebozoaCapsasporaIchthyosporeaExcavatesCercozoaRhizariaOpisthokonts'UnikontsTRENDS in Ecology & Evolutiona. Describe two types of proteins that you would study to determine phylogeneticrelationships among eukaryotes. Describe one protein you might study to determinedifferences between a eukaryote and a prokaryote.b. Given the following scanning electron image, what general type of cell are we lookingat and why?1.0 umc. As a researcher, you were able to sequence a circular piece of DNA from the organism

The proteins that are studied are chosen on the basis of the fact that they remain conserved in all…

ven the following scanning electron image, what general type of cell are we looking and why? 1.0 um a researcher, you were able to sequence a circular piece of DNA from the organism OW: 08363 w would you go about determining if the organism is a prokaryote or eukaryote?

ven the following scanning electron image, what general type of cell are we looking and why? 1.0 um a researcher, you were able to sequence a circular piece of DNA from the organism OW: 08363 w would you go about determining if the organism is a prokaryote or eukaryote?

Biomedical Instrumentation Systems

1st Edition

ISBN:9781133478294

Author:Chatterjee

Publisher:Chatterjee

Chapter24: New Technologies And Advances In Medical Instrumentation

Section: Chapter Questions

Problem 10P

See similar textbooks

Related questions

Q: Cleaner fish can recognise their neighbour Cleaner fish become less aggressive to their neighbour…

A: The experiment is all about the social behaviour of the cleaner fish that is how do they interact…

Q: A facultative aerobe can live only in the absence of oxygen. True False

A: Bacteria is a ubiquitous microscopic prokaryotic organisms which does not have membrane bound…

Q: There are some exceptional free living organisms from the tree of life that lack rRNA true or…

A: Ribosomal RNA (rRNA) is a type of RNA molecule that is a fundamental component of ribosomes, the…

Q: I do a lot of things to improve my cardiovascular system. As a soccer player, I need to be…

A: The condition of the heart and blood arteries is referred to as cardiovascular health. Heart and…

Q: A color-blind man has a son with a color-blind female. Will their son be colorblind? What is a…

A: Introduction X-linked recessive is a type of inheritance pattern for certain genetic disorders that…

Q: 1)From Table 3, compute the mortality rate ratio for diabetes for Asian Americans compared to White…

A: Introduction Mortality refers to the occurrence of death within a population. It is the number of…

Q: Lipid excess can lead to O None of the choices are correct O b. Weight loss O a. Obesity O c. Skin…

A: Lipids are a diverse group of organic molecules that are insoluble in water but soluble in organic…

Q: https://pubmed.ncbi.nlm.nih.gov/28671715/ Discuss the chimpanzee species is an endangered, by using…

A: A chimpanzee is a great ape and one of the closest living relatives to humans. They are native to…

Q: Male sword evolves. Female sensory bias evolves. Swordtail fishes Priapella Xiphophorus d Priapella…

A: Option 2 and option 3 are correct answers.

Q: Explain what would happen to a red blood cell that is placed in the following solutions: a)…

A: A solution is generally composed of two components that are solvent (liquid mostly) and solute…

Q: Throughout downstream processing, various analytical methods must be used to evaluate the…

A: In downstream processing, analytical methods are used to separate the desired product from a mixture…

Q: Which of the following chromosome rearrangement genotypes and/or processes involving the described…

A: Introduction :- Gametes are reproductive cells that are responsible for sexual reproduction. They…

Q: Predict which of the following participants in the energy investment phase of glycolysis will have…

A: Glycolysis is a sequence of events that derive energy from glucose by breaking it into two…

Q: Give possible thesis title on seaweeds and enumerate 3 objectives

A: A thesis is a long-form academic paper that presents an original research study or argument on a…

Q: Assume that a gene controls the expression of a trait in which affected children occur only in…

A: The question is asking about the mode of inheritance for a trait that appears to only affect…

Q: You study the differentiation of embryonic cells into astrocytes, a process that takes a few days in…

A: Living cells are used in biotechnology to produce a variety of products, such as vaccines,…

Q: 3. Most cases of achondroplasia occur because of the father passing the abnormal gene to his…

A: Introduction :- Achondroplasia is a genetic disorder that affects bone growth and results in…

Q: Is there a distinction between the temporal features of the human vision system and its optical…

A: The optical qualities of the eye refer to its physical properties that enable it to form clear…

Q: Your friend wants to develop a new method to map the transcription start and end sites of a target…

A: Introduction Transcription is the process by which genetic information in DNA is used to synthesize…

Q: Retinitis pigmentosa, a form of blindness in man, maybe caused either by a dominant autosomal gene…

A: Given that, there are two genes which control retinitis pigmentosa. It can be caused by dominant R…

Q: Identify the chromosome rearrangement that occurred between the two homologous chromosomes shown on…

A: Mutation: Mutation refers to any change or alteration that occurs in the genetic material (DNA) of…

Q: In humans, dark hair (D) is dominant over blondness (d), and color blindness (c) is a sex-linked…

A: The probability that a colorblind son has dark hair is determined by the gene combinations of his…

Q: Compare saturated, monosaturated, polyunsaturated, and trans fatty acids

A: Essential Fatty Acids: Essential fatty acids are types of fats that our bodies require for normal…

Q: Which of the following occurs during glycolysis? a) the formation of four ATP molecules b) the…

A: The "cell is the essential structural and functional unit of living beings. This implies that cells…

Q: 10. Fur colour in mice is an example of the effects of interaction between different genes. Wild…

A: A Punnett square is a diagram used to predict the probability of offspring genotypes resulting from…

Q: How does glucose change at the beginning of glycolysis? a) An atom of oxygen is removed. b) It…

A: Glycolysis: The process where glucose which is a six-carbon compound is broken down into…

Q: Why is the virus phylogeny difficult to resolve (check all that apply) No fossil record Small…

A: Throughout the course of what is known as evolution, biological species, including viruses, evolve…

Q: Details For this assignment, draw and label a chloroplast. Indicate which step of photosynthesis…

A: Chloroplasts are specialized organelles found in plant cells and other eukaryotic organisms that…

Q: Which of the following is the final electron acceptor in the electron transport chain in the…

A: Electron transport chain is the step of cellular respiration which happens in eukaryotic…

Q: Elaborate the outdoor condition including "Temperature, Humidity, and Wind Conditions" when…

A: Introduction Cryogenic plants are industrial facilities that use a process called cryogenics to…

Q: A survey through 23andMe.com found that of 4737 individuals of European ancestry, 3002 said they…

A: As per Hardy Weinberg Equilibrium , allele as well as genotype frequency remain constant from…

Q: he diagram to describe metabolic pathways for either a protein or a lipid. fats ►NH₂ ADP + P NAD NAD…

A: Fats are the biomolecules or the nutrients which are made up of the monomers called three fatty…

Q: How does Glycosidic Linkage help identify lipids?

A: Introduction Lipids are a broad class of organic molecules that are insoluble in water but soluble…

Q: garden peas tall vine is dominant over short vine and round pea pod is dominant over wrinkled pea…

A: Introduction: The phrases heterozygotes and homozygotes are used to characterise a person's genetic…

Q: 4. Which of the following is not a way a pregnant woman could potentially come in contact with lead,…

A: Introduction Birth defects are abnormalities that occur in a baby's body structure or function…

Q: 7. Red blood cells can possess a surface antigen called the Rhesus (Rh) factor. Rh+ (presence of the…

A: Introduction :- The Rhesus factor (Rh factor) is a protein that is present on the surface of red…

Q: Are there any nutritional risks vegetarians should be aware of?

A: Introduction :- Vegetarians are individuals who abstain from eating meat, poultry, and seafood, and…

Q: The following groups of protists will be covered in lecture: Amoebazoa, Excavate-euglena,…

A: Protists are a diverse group of eukaryotic organisms that are not plants, animals, or fungi. They…

Q: Discussion 3.1 Comparing the Utilitarian Approach with Other Approaches After carefully reading the…

A: Introduction Euthanasia is the deliberate taking of a life to end pain and suffering. The…

Q: What are the membranous structures that protect the developing embryo in an egg? Describe each.

A: Female reproductive system is a system exhibited inside the female in which egg formation occur and…

Q: What does pyruvate oxidation entail? a) the formation of NADH b) coenzyme A c) the release of carbon…

A: Pyruate is the end product of glycolysis. It is a three carbon molecule. It undergoes oxidation and…

Q: hi can you please help me review this vedio including vedio topic presented, the information…

A: CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a revolutionary gene-editing…

Q: Estimate the concentration of your PCR product (amplicon) in ng/μL by visual comparison. 10 μL of…

A: Polymerase chain reaction (PCR) is a technology that is used to target specific DNA fragments and…

Q: Outline possible advantages and disadvantages for organisms in using: (a) anaerobic respiration (b)…

A: Cellular respiration is a metabolic pathway to harness energy from the carbohydrates obtained from…

Q: Part II. Solving Genetics Problem. Do what is asked. Show your solution. A. Monohybrid Cross 2. Long…

A: Introduction :- Cross in genetics is basically experimental breeding between two organisms or plants…

Q: What is true of oxidative phosphorylation? a) It can occur only in the presence of oxygen. O b) It…

A: The final stage of cellular respiration is oxidative phosphorylation. It involves the transfer of…

Q: label the following structures into the mammalian ovary. A. Tunica albuginea B. Primordial follicle…

A: Introduction - - Single layer cuboidal shaped follicular cells divide rapidly to form six to seven…

Q: the maintenance energy need for a 80 lb growing lamb in kcal of NEm/day

Q: How to cross the following on a punnette square RRYYCC x rryycc

A: Introduction A trihybrid cross is a type of genetic cross between two individuals that are…

Q: Glucagon release triggers an increase in activity in mitochondrial pyruvate carrier (MPC). Which of…

A: Introduction :- Glucagon is a hormone produced by the pancreas that plays a key role in regulating…

Question

b. Given the following scanning electron image, what general type of cell are we looking
at and why?
HIGH
1.0 um
c. As a researcher, you were able to sequence a circular piece of DNA from the organism
below:
cace
M40205330
08363
CODDEGOED
How would you go about determining if the organism is a prokaryote or eukaryote?

Plantae
1. Molecular and microscopy analyses have provided evidence for relationships among 75
lineages of eukaryotes and their distinctness from prokaryotes.
Green Algae
Red Algae
Alveolates
Stramenopiles
Chlorophytes
Trebouxiophytes
Floridiophytes
Bangiophytes
Cyanidiophytes
Glaucophytes
Apicomplexa
Colpodella
Dinoflagellates
Ulvophytes
Prasinophytes
Mesostigma
Oxyhrris
Perkinsus
Ciliates
Colponema
Ellobiopsids
Diatoms.
Raphidiophytes
Eustigmatophytes
Chromalveolates
Chrysophytes
Phaeophytes
Bolidophytes
Blastocystis
Actinophryids
Labyrinthulids
Thraustrochytrids
Streptophytes
Land plants
Charophytes
Oomycetes
Opalinids
Bicosoecids
Haptophytes
HIGH
Cryptomonads
Discicristates
Heterolobosea
Kinetoplastids
Diplonemids
Euglenids
Core jakobids
Trimastix
Oxymonads
Trichomonads
Lobosea
Archamoebae
Hypermastigotes
Carpediemonas
Retortamonads
Diplomonads
Malawimonads
Cercomonads
Euglyphids
Phaeodarea
Heteromitids
Dictyostelids
Myxogastrids
Protostelids
Phytomyxids
Haplosporidia
Thaumatomonads
Chlorarachniophytes
Foraminifera
Polycystines
Acantharia
Ascomycetes
Basidiomycetes
Zygomycetes
Microsporidia
Chytrids
Nucleariids
Animals
Choanoflagellates
Amoebozoa
Capsaspora
Ichthyosporea
Excavates
Cercozoa
Rhizaria
Opisthokonts
'Unikonts
TRENDS in Ecology & Evolution
a. Describe two types of proteins that you would study to determine phylogenetic
relationships among eukaryotes. Describe one protein you might study to determine
differences between a eukaryote and a prokaryote.
b. Given the following scanning electron image, what general type of cell are we looking
at and why?
1.0 um
c. As a researcher, you were able to sequence a circular piece of DNA from the organism

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Since DNA is a hydrophillicmoelcule, it cannot pass through cell membranes. Name and explain the technique with which the DNA is forced into (ii) a bacterial cell (ii) a plant cell (iii) an animal cell.
Which of the following is the prokaryotic helicase? DnaB DnaD DnaA DnaC
How to write the methodology? I have a practical of HOMOGENIZATION AND FREEZE-DRYING, I need to do a lab report, but I don't know how to write the methodology. Here is the introduction: HomogenizationHomogenization is a process that involves breaking apart cells to release theircytoplasm and its contents. When the purpose is to extract organelles, it is frequentlydone in two steps; first, using a blender to break the tissue up, and then with anultrasonic or mechanical tissue disruptor. The organelles are then generally separatedusing differential centrifugation.Freeze-dryingFreeze-drying also known as lyophilization, and it is a dehydration process typicallyused to preserve perishable material or make the material more convenient fortransport. It works by freezing the material and then reducing the surrounding pressureto allow the frozen water in the material to sublimate directly from the solid phase tothe gas phase.
43) The major setback for the use of Transmission Electron Microscope is that: a) You can’t stain the sample with colored dyes b) You can’t see internal structures of the cell c) You can’t focus on Organelles inside the cell d) you can’t focus on cell membranes44) The major advantage of using the Scanning Electron Microscope (SEM) over the Transmission Electron Microscope (TEM) is that: a) You can use live material in looking through the SEM and not the TEM b) You can look at internal structures with SEM & not TEM c) You can use higher magnifications with SEM d) You can look at solid objects with SEM45) The image that you are observing in the SEM comes from: a) Direct reflection/bouncing of electrons from the specimen you are looking at b) Backscattered electros from the secondary electrons from the specimen c) A contrast between the texture of the specimen you are looking at d) A contrast between the acidophilic and basophilic components of the specimen you are looking at46) A…
what is the phrase under DNA - "cellular life..." ?
24. it consists of cellulose and glycoproteins that protect and provide structural support to the cella. cell membraneb. cell wallc. plastidd. nucleoplasm25. this part of the cell is described as a heterogeneous, colored plastid responsible for pigment synthesis in eukaryotic organisms.a. chloroplastsb. ribosomesc. golgi apparatusd. chromoplast
2)One strand of DNA reads: CGACTTCAGAT What would the complementary strand be?
It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand: GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT It is now time to make a protein. Using the same stand of DNA, transcribe it to mRNA, then translate to an amino acid sequence (use the codon table below).
During transformation a cell usually incorporates only one or afew fragments of DNA. Explain.
I answered the question with 'cell wall' only, but was only given half credit. After reading differences between prokaryotic and eukaryotic, I am not sure if one of these other options could also be selected (and if so, why?) Thank you for your help.
. Which of the following characteristics of chloroplastsand/or mitochondria make them seem more similar tobacterial cells than to eukaryotic cells?a. Translation is sensitive to chloramphenicol anderythromycin.b. Alternate codons are used in mitochondria genes.c. Introns are present in organelle genes.d. DNA in organelles is not arranged innucleosomes.
Which of the following statements is (are) true? (a) Bacterial ribosomes consist of 40S and 60S subunits. (b) Prokaryotic DNA is normally complexed with histones. (c) Prokaryotic DNA normally exists as a closed circle. (d) Circular DNA is supercoiled.